Head over to https://www.kiwico.com/thoughtemporium and use code THOUGHTEMPORIUM to get 50% off your first monthly club crate! _____________________________________________________________________________________ Get your mad science merch here: https://thethoughtemporium.ca/ ___________________________________________________________________ Jenny's build files here: https://github.com/thethoughtemporium/radio-telescope ___________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/ ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Bsky: https://bsky.app/profile/thethoughtemporium.bsky.social Website: http://thethoughtemporium.com/ Newsletter: https://thethoughtemporium.ca/pages/newsletter _____________________________________________________

Visit https://brilliant.org/TheThoughtEmporium/ to get started learning for free for 30 days, and 20% off their annual premium subscription. _______________________________________________________ Get your mad science merch here: https://thethoughtemporium.ca/ ___________________________________________________________________ Check out Ben's great video's: https://www.youtube.com/@UCFtc3XdXgLFwhlDajMGK69w ___________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/ ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ Newsletter: https://thethoughtemporium.ca/pages/newsletter _____________________________________________________

Visit https://brilliant.org/TheThoughtEmporium/ to get started learning for free for 30 days, and 20% off their annual premium subscription. _______________________________________________________ Get your mad science merch here: https://thethoughtemporium.ca/ _______________________________________________________ More resources: Microdot video: https://youtu.be/nqRtzQOf0Xk Hologram Lasers: https://youtu.be/atg1PN1sZfg ___________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/ ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ Newsletter: https://thethoughtemporium.ca/pages/newsletter _____________________________________________________

Head to https://go.nebula.tv/thethoughtemporium to sign up today and upgrade your viewing experience! _______________________________________________________ Get your mad science merch here: https://thethoughtemporium.ca/ _______________________________________________________ More resources: diffractsim: https://github.com/rafael-fuente/diffractsim?tab=readme-ov-file our github: https://github.com/thethoughtemporium tech ingredients: https://www.youtube.com/@UCVSHXNNBitaPd5lYz48--yg applied science: https://www.youtube.com/@UCivA7_KLKWo43tFcCkFvydw codyslab: https://www.youtube.com/@UCu6mSoMNzHQiBIOCkHUa2Aw huygens optics: https://www.youtube.com/@UC26YLK0OEbLB3TCYxGh8xVQ NightHawkInLight: https://www.youtube.com/channel/UCFtc3XdXgLFwhlDajMGK69w ___________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/ ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________

Get NordVPN 2Y plan + 4 months extra plus up to 20 GB Saily data voucher ➼ https://nordvpn.com/thoughtemporium It’s risk-free with Nord’s 30-day money-back guarantee! ______________________________________________________________________ Help support our work and get your poster here: https://thethoughtemporium.ca/products/asteroids-neuron-array-poster Screen printed by La Bourgeoise Sérigraphe: https://www.labourgeoiseserigraphe.com/en ________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Nebula: https://go.nebula.tv/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/

Use code thoughtemporium at the link below to get an exclusive 60% off an annual Incogni plan: https://incogni.com/thoughtemporium _________________________________________________________________________ Help support our work and get your poster here: https://thethoughtemporium.ca/products/asteroids-neuron-array-poster Screen printed by La Bourgeoise Sérigraphe: https://www.labourgeoiseserigraphe.com/en _________________________________________________________________________ Special thanks to Multichannel Systems for Providing the arrays and recording system! You can find their whole catalogue of arrays and tools here: https://multichannelsystems.com/ ________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Nebula: https://go.nebula.tv/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/ ________________________________________________________________________ More resources: https://www.jove.com/t/2056/how-to-culture-record-stimulate-neuronal-networks-on-micro-electrode https://potterlab.gatech.edu/publications/ https://journals.plos.org/ploscompbiol/article/file?id=10.1371/journal.pcbi.1000042&type=printable https://www.nature.com/articles/s41928-023-01069-w https://engineering.cmu.edu/news-events/news/2022/09/23-neuron-modeling.html http://www.scholarpedia.org/article/Spike-timing_dependent_plasticity https://www.youtube.com/watch?v=oG0PTP3ogCA https://www.youtube.com/watch?v=HN1iX_3CXLY _______________________________________________________________________ Previous Episode: https://youtu.be/bEXefdbQDjw First Try: https://youtu.be/V2YDApNRK3g Meat Robot: https://youtu.be/JNfQCRzcr3o Meatcubator: https://youtu.be/Z_ZGq8Tah0k Meat in Gatorade: https://youtu.be/EJG3t5Omteg Plasma Metal Coating: https://youtu.be/XHQxghdj2ks

Head to https://go.nebula.tv/thethoughtemporium to sign up today and upgrade your viewing experience! _______________________________________________________ Get your mad science merch here: https://thethoughtemporium.ca/ _______________________________________________________ More resources: Shojinmeat: https://shojinmeat.com/wordpress/ Meat leaf: https://youtu.be/JNfQCRzcr3o Doom Neurons: https://youtu.be/bEXefdbQDjw Meatcubator: https://youtu.be/Z_ZGq8Tah0k ___________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/ ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________

Head to https://thethoughtemporium.ca/ today and get something that shows off your mad science flair! The first 50 people to use the code "manbat" will get 10% off their order, or use the link below! https://thethoughtemporium.ca/discount/manbat ____________________________________________________________________ Come to open sauce!! Exhibit Application link: https://opensauce.com/exhibit-application Ticket link: https://opensauce.com/tickets ___________________________________________________________________ More resources: https://www.ebay.ca/itm/204490538445 https://acoustics.org/pressroom/httpdocs/154th/aytekin.html https://acoustics.org/3auw8-a-view-askew-bottlenose-dolphins-improve-echolocation-precision-by-aiming-their-sonar-beam-to-graze-the-target-laura-n-kloepper/ https://royalsocietypublishing.org/doi/10.1098/rspb.2008.1505 ____________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://thethoughtemporium.ca/ ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________

Get Nebula using my link for 40% off an annual subscription: https://go.nebula.tv/thethoughtemporium ____________________________________________________________________ More resources: Mummification video: https://youtu.be/fbhV0TP3jco Chemteacherphil's video: https://www.youtube.com/watch?v=pb0ctuKCQn8&t=1s ____________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://the-thought-emporium.creator-spring.com ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________

Get Nebula using my link for 40% off an annual subscription: https://go.nebula.tv/thethoughtemporium Watch the bonus video here: https://nebula.tv/videos/thethoughtemporium-making-an-egyptian-mummy-bonus-video ____________________________________________________________________ Get your mummification instruction here: https://thethoughtemporium.etsy.com/ca/listing/1582021004/mummy-assembly-instructions-poster Screen printed by La Bourgeoise Sérigraphe: https://www.labourgeoiseserigraphe.com/en ____________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://the-thought-emporium.creator-spring.com ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________

Head to https://squarespace.com/thethoughtemporium to save 10% off your first purchase of a website or domain using code: thethoughtemporium _______________________________________________________ How many chemicals does is take to make chicken soup? Today we find out. Taste Emporium: https://www.youtube.com/c/thetasteemporium Original Patent: https://patentimages.storage.googleapis.com/ef/9e/e4/81fcd06474f18a/US3689289.pdf _______________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://the-thought-emporium.creator-spring.com ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________

Head to https://squarespace.com/thethoughtemporium to save 10% off your first purchase of a website or domain using code: thethoughtemporium _______________________________________________________ Lactose GMO: https://www.youtube.com/watch?v=J3FcbFqSoQY _______________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://the-thought-emporium.creator-spring.com ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________ 0:00 Intro 0:46 Invention of Milk Yarn 2:55 Why this works 3:55 sponsor 4:28 How to make fiber 6:35 Wet spinning machine 7:56 Making Goop 11:00 Making Rope 12:30 Tensile Testing

Head to https://squarespace.com/thethoughtemporium to save 10% off your first purchase of a website or domain using code: thethoughtemporium _______________________________________________________ First Episode: https://youtu.be/V2YDApNRK3g Meat robot: https://youtu.be/JNfQCRzcr3o Meatcubator: https://youtu.be/Z_ZGq8Tah0k _______________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u ______________________________________________________ Our Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________ More resources: Rat Brain Flight https://www.youtube.com/watch?v=1w41gH6x_30&t=2s Neuron Robot https://www.youtube.com/watch?v=63itUhH3ac8 Pong https://www.youtube.com/watch?v=GJaXiR_uvVI Organoids https://www.spectrumnews.org/news/toolbox/new-method-probes-genes-function-in-brain-organoids/ Growing neurons https://www.youtube.com/watch?v=golqIqArZEk&t=1s microfluidic organoid https://pubs.rsc.org/en/content/articlelanding/2021/lc/d0lc01186j _____________________________________________________ 0:00 Intro 1:50 Past examples 3:00 How this works 9:55 sponsor 10:47 Where we're at 14:00 growing neurons 20:00 results 23:30 Next time ____________________

We made a meat-leaf. What more really needs to be said? Well it's also a demonstration of the cutting edge of regenerative medicine, and bioengineering. And maybe the first stop on the road to meat-robots. Previous videos: Meat berry - https://youtu.be/FaVHTd9Ne_s Neurons - https://youtu.be/V2YDApNRK3g Meatcubator - https://youtu.be/Z_ZGq8Tah0k More resources: https://doi.org/10.1016/j.fbio.2021.100986 https://www.pellinglab.net/ https://www.youtube.com/watch?v=KNHgeykDXFw https://wyss.harvard.edu/news/biohybrid-fish-made-from-human-cardiac-cells-swims-like-the-heart-beats/ https://www.nytimes.com/2008/01/13/health/13cnd-heart.html ___________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Dye lasers are amazing because they are a high power source of laser light in essentially any color. And best of all you can switch colors in as long as it takes to change the liquid. Today we explore how they're made, how they work, and how a laser made of garbage could be the secret to making a meat laser. 3d files: https://github.com/thethoughtemporium/Dye-Laser Previous videos: Meatcubator https://www.youtube.com/watch?v=Z_ZGq8Tah0k Genetically modifying Bacteria https://www.youtube.com/watch?v=F0_q-fD_lyU Designing DNA https://www.youtube.com/watch?v=E_TAHxPBqKY Magnetron https://www.youtube.com/watch?v=aljbjJbfghs Videos from other channels: Styropyro https://www.youtube.com/watch?v=1psxE4NlECQ Les' Lab https://www.youtube.com/watch?v=pCnXftuJ9Zo Plasma channel https://www.youtube.com/watch?v=YFkUOPl0tUw 0:00 Introduction 4:09 TEA lasers 6:42 Building the Laser 9:38 Dye lasers 13:15 changing colors 14:54 wrap up 16:00 opensauce ___________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Head on over to https://www.thebismuthsmith.com/giveaway-lucky-winner/ to enter the draw! ___________________________________________________________________________ Today we're testing if shear thickening fluid can make thehacksmith's john wick style three piece suit strong enough to stop bullet! Check out their video and see the whole suit be made here: https://www.youtube.com/watch?v=Eeb4aZObp-0 ___________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

This amazing machine allows scientists to grow animal cells.... outside of an animal. Today we explore how we built it, how it works, and then take it for a test drive by growing some mouse fibroblast cells. Github: https://github.com/thethoughtemporium/meatcubator Andrew Pelling's incubator: https://www.pellinglab.net/post/diy-incubator Past videos: Meat berry - https://youtu.be/FaVHTd9Ne_s Neuron project 1 - https://youtu.be/V2YDApNRK3g Neuron stream - https://youtube.com/live/p1C0qpqpAWc?feature=share 0:00 Intro 0:41 Previous Projects 2:00 Building the incubator 5:00 Choosing Cells 6:41 Growing Cells 12:00 Future Outlook _______________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Tiktok: https://www.tiktok.com/@thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I made a bacteria that can turn alcohols into nice smelling acetates. Unfortunately one of them also attracts angry bees.

We're back! Today we're going over the new and improved plan for attempt 2 of the neuron project. Donations: https://streamlabs.com/thethoughtemporium More resources: https://twitter.com/lab_costa/status/1281282773647572992?s=20&t=VTpel-5PNTjFZ8sDpE-8bw https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7363313/ https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-018-0480-0 https://pubmed.ncbi.nlm.nih.gov/33020606/ https://potterlab.gatech.edu/labs/potter/animat/ https://t.co/UT9UVfJrpR https://twitter.com/DubladJitender/status/1482624704129212419?s=20&t=VTpel-5PNTjFZ8sDpE-8bw https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5034306/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3713494/ https://www.pnas.org/doi/10.1073/pnas.1000887108 https://www.youtube.com/watch?v=FGvp6cdKb3c https://www.nature.com/articles/nmeth.2434 https://www.pnas.org/doi/abs/10.1073/pnas.1703084114 https://intantech.com/ https://braingeneers.ucsc.edu/ _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Visit https://brilliant.org/TheThoughtEmporium/ to get started learning STEM for free, and the first 200 people will get 20% off their annual premium subscription ________________________________________________________________________ Materials I used: Ease Release 200 smooth-cast 300 reoflex 30 Easyflo 60 Smooth-sil 945 Mold Max 15t _______________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________

Go to https://brilliant.org/thethoughtemporium to get started learning today! __________________________________________________________________________ This machine, is as close to magic as we've come as a species. It takes a sheet of metal, turns it into plasma and then can coat literally anything in that metal. Today we discuss how we built this incredible machine! Github repo of parts: https://github.com/thethoughtemporium/sputteringsystem Part 1- https://youtu.be/XHQxghdj2ks Ben's amazing videos: Main channel page - https://www.youtube.com/c/AppliedScience/ https://www.youtube.com/watch?v=9v0r66N7mPw https://www.youtube.com/watch?v=DZGTh3hGzNc https://www.youtube.com/watch?v=9OEz_e9C4KM https://www.youtube.com/watch?v=atVSxvbiPg0 https://www.youtube.com/watch?v=5X0EKbpLuRc ________________________________________________________________ Chapters: 0:00 Intro 3:33 Sourcing materials 4:30 Cart 6:20 Base PLate 7:45 Choosing vacuum materials 10:40 Baffle 13:20 Sputter Head 17:20 Rotary Couplings 19:11 High Current Feedthrough 20:34 Gas Flow Valves 21:40 Sponsor 22:36 Next Time Sneak Peek ________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________

Go to https://curiositystream.com/ThoughtEmporium or use the coupon code "ThoughtEmporium" to get a whole year of documentaries and non fiction tv for just 14.99! ________________________________________________________________________ Previous videos: Neuron project - https://www.youtube.com/watch?v=V2YDApNRK3g First working magnetron - https://youtu.be/EMzRZ4gXQ-0 First working thermal - https://youtu.be/-lh1LhoRBaY Ben's amazing videos: Main channel page - https://www.youtube.com/c/AppliedScience/ https://www.youtube.com/watch?v=9v0r66N7mPw https://www.youtube.com/watch?v=DZGTh3hGzNc https://www.youtube.com/watch?v=9OEz_e9C4KM https://www.youtube.com/watch?v=atVSxvbiPg0 https://www.youtube.com/watch?v=5X0EKbpLuRc ________________________________________________________________ Chapters: 0:00 Intro 3:33 Subsystem Breakdown 3:50 Vacuum System 6:30 Gas System 7:50 Power System 8:58 Cooling System 9:37 Coating a Microscope Slide 14:15 Coating Different Things 18:20 Why Did We Build This? ________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________

Go to https://curiositystream.com/ThoughtEmporium or use the coupon code "thoughtemporium" to get a whole year of documentaries and non fiction tv for just 14.99! _________________________________________________________________________________________________ I spent the last 5 months building the lab of my dreams. This place is incredible! ________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________

Check out The Bismuth Smith, and get 20% off your first order when you use the code "thought20" at checkout: https://thebismuthsmith.com ---------------------------------------------------------------------------------------------------------------------- Every second of every day thousand of cosmic rays pass through you, but we normally never notice. These particles are the result of high energy collisions in the upper atmosphere called air showers that are the result of some of the most extreme events in the universe flinging particles through deep space. Today we detect and measure these amazing particles and see how they can be used to directly test special relativity, catch smugglers and even find hidden passages in Egyptian tombs. Extra reading/videos: Source paper -https://www.researchgate.net/publication/275467414_Special_relativity_in_the_school_laboratory_A_simple_apparatus_for_cosmic-ray_muon_detection Pair production and antimatter - https://youtu.be/K16uPl6_S7A Muons could break the standard model - https://www.youtube.com/watch?v=O4Ko7NW2yQo Air showers - https://twiki.cern.ch/twiki/pub/MATHUSLA/MATHUSLAPublic/cosmic-ray-physics_MATHUSLA.pdf Hadronization - https://indico.cern.ch/event/314801/contributions/1688594/attachments/603731/830823/Jet_WS_2014_RJF.pdf Pions - Kaons - _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://www.redbubble.com/people/chironex/shop?asc=u _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________

Head on over to Opentrons to learn more about their incredible robot: https://opentrons.com/ ________________________________________________________________________________________________ A liquid handling robot is basically a genetic engineer's dream. They can save a ton of time, streamline workflows, and generally make life in the lab easier. Today I'm showing off my new OT-2 from opentrons and using it to make bacterial paintings. Github: https://github.com/thethoughtemporium/bioart Previous videos: Genetically modifying bacteria - https://youtu.be/TtmVfWj20nY Neuron project - https://youtu.be/V2YDApNRK3g 3d printer files: https://github.com/Opentrons/otone_hardware https://2019.igem.org/Team:Marburg/Hardware Special thanks to Jonah from inventability.ca for the 3d printed racks __________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

We're back! Today is going to be a chill stream of designing DNA, and a lot of updates. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

For NordVPN’s 9th birthday, every purchase of a 2-year plan will get you 1 additional month free AND a surprise gift. Go to https://www.nordvpn.com/thoughtemporium and use code thoughtemporium! ________________________________________________________________________ BL21 E. coli are by far the most obnoxious bacteria genetic engineers usually work with for 1 simple reason. They are maddeningly difficult to modify and load with new DNA. This wouldn't be an issue if they weren't also one of the best types for producing proteins en mass, and as such have application in everything from pharmaceutical production, to producing ingredients for foods. But after a few years of tinkering with it I finally found a protocol that reliably fixes this irritating issue, and makes it easy to transform them reliably. Written protocol - https://github.com/thethoughtemporium/Protocols/blob/main/Transformations/bl21%20transformation.md Sebastian's spinner - https://www.tinkercad.com/things/5t5GqlGkK1i Previous videos; Modifying Bacteria - https://youtu.be/F0_q-fD_lyU Modifying yeast - https://youtu.be/DHNPnO5UOYQ Making a heat block/incubator - https://youtu.be/Zm378x6zJYc Growing spider silk -https://youtu.be/2hf9yN-oBV4 ___________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Go to https://nordvpn.com/thoughtemporium or use code thoughtemporium to get a 2-year plan plus 1 additional month with a huge discount. __________________________________________________________________________ Last year I demonstrated that many negative ion products are actually radioactive. Since then, my video prompted amazon to pull dozens of items from their store and at least 2 companies have shut down. This time we talk about that exciting update and some new, and even more radioactive quack products I found. Previous video - https://youtu.be/C7TwBUxxIC0 NRC - https://www.nrc.gov/ ___________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I spent December learning how to digitally paint. This was my fifth painting and for it I chose the bath house from spirited away as the subject. My other paintings can be found here: https://www.artstation.com/thethoughtemporium _________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

On today's special stream I'll be talking to the fantastic Dr. Mixael Laufer who runs the Four Thieves Vinegar Collective. The collective is an anarchist group focused on providing open source methods for producing medicines which are otherwise egregiously expensive or impossible to get access to. One example we'll be talking about is their epi-pencil: a 3d printed alternative to an epipen that costs only a few dollars to make compared to the several hundreds it costs to buy an epipen. His group has done some amazing things and this ought to be a great discussion. Mixael's links: Four Thieves Vinegar Collective - https://fourthievesvinegar.org/download Twitter - https://twitter.com/MichaelSLaufer Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Special Christmas deal! Get 68% off of a 2-year plan and get an 4 additional months free. Just go to https://nordvpn.org/thoughtemporium and use our coupon code thoughtemporium at checkout. __________________________________________________________________________ Opal is easily one of the most beautiful gem stones and surprisingly it is also quite easy to grow synthetically. Unlike other gems which are solid crystals, opal is made of silica nanoparticles which have to be stacked together in just the right way to produce their magnificent colors. By growing silica nanoparticles of the right size, synthetic opal can be grown that looks just as amazing as the real thing. Videos/channels I mentioned: Smartereveryday - https://www.youtube.com/watch?v=zHecdSDz4uU Nilered - https://www.youtube.com/watch?v=Y0HfmYBlF8g Applied science - https://www.youtube.com/user/bkraz333 Papers: Stober process - https://link.springer.com/content/pdf/10.1007%2Fs11051-016-3691-8.pdf Opal preparation - http://www.pinfire.de/opal-literature/Some-Aspects-of-Opal-Synthesis.pdf Supercritical opal drying - https://www.researchgate.net/publication/273286020_The_application_of_supercritical_drying_in_the_synthesis_of_silica-based_materials _________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Get your hologram film today at: https://litiholo.com/hologram-film.html?te And to learn more about the hologram printer go to: https://www.litiholo.com/3d-hologram-printer.html?te ______________________________________________________________________ Holograms are truly an amazing trick of physics that allow you to capture a 3d image and save it on a photographic plate. But unlike a traditional photo all the 3d information is retained allowing you to view objects from different angles. Today we're going to be looking at how holograms are made, the different recording media, and some properties of light that allow these amazing images to be captured. Materials: Blue laser - https://www.amazon.ca/gp/product/B07K5LSJCC Green laser - https://www.amazon.ca/gp/product/B018C9A9AG/ref=ppx_yo_dt_b_search_asin_title?ie=UTF8&psc=1 Beam splitter cube - https://www.amazon.ca/gp/product/B07PMCM8HP/ref=ppx_yo_dt_b_asin_title_o03_s00?ie=UTF8&psc=1 _________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're again talking about the art of planning a project. From where to source materials, to how to break down problems into manageable pieces, there's a lot to cover. Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter - https://twitter.com/glimsd?lang=en Scihouse discord - https://discord.gg/t6hJEVz Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

The first 200 people to sign up with Brilliant using my link will get 20% off the annual subscription! http://brilliant.org/thethoughtemporium _________________________________________________________________________ Earth these days is getting a little bit crazy. Thanks to this year's fire season even though I live on the opposite side of the continent I couldn't open my doors or windows without triggering an asthma attack. So I decided I would build a space suit... but for earth. Complete with daft punk respirator, and blower unit, the suit is equipped with n95 filters that make all the air clean and fresh, while I travel in style. Want one for yourself? Check out the 3D files on our github page: https://github.com/thethoughtemporium/PAPR Jonahs Links: Kits/parts - https://www.etsy.com/ca/shop/Inventability Website - https://www.inventability.ca/ Instagram - https://www.instagram.com/inventability.ca/ Patreon - https://www.patreon.com/inventability Parts list: Voltage booster - https://www.amazon.ca/KeeYees-MT3608-Converter-Adjustable-2V-24V/dp/B0816T1VCQ Micro USB port - https://www.amazon.ca/Micro-Interface-Adapter-Breakout-Module/dp/B07B5ZDLJY Switch - https://www.amazon.ca/gp/product/B07GQHB45V/ Fans - https://www.amazon.ca/Security-01-Bearing-Brushless-Cooling-AV-F7530MB/dp/B072HJ38PS Helmet - https://www.etsy.com/ca/listing/649074736/daft-punk-helmet-kit?ref=shop_home_active_11&cns=1 Gold paint - https://www.amazon.ca/gp/product/B07R95XSXJ Jacket - https://www.amazon.ca/gp/product/B07VL1YLNX _________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

The first 200 people to sign up with Brilliant using my link will get 20% off the annual subscription! http://brilliant.org/thethoughtemporium _________________________________________________________________________ What started as a dream more than 10 years ago, has finally become reality. After more than 2 years of work, dozen of failures, hundreds of hours of lab work and design time, we've finally done it. We've engineered a strain of yeast that produce real spider silk! This video explains how. Check out our new merch: https://teespring.com/stores/the-thought-emporium Previous videos: Project overview - https://www.youtube.com/watch?v=Fx8TcGrCOSI DNA extraction - https://www.youtube.com/watch?v=knosqmvLWSc PCR - https://www.youtube.com/watch?v=7kJ2o7P8D00 Journey to the Microcosmos - https://www.youtube.com/channel/UCBbnbBWJtwsf0jLGUwX5Q3g _________________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're again talking about neurons! We'll cover different ways to visualize them, engineer them, and interact with them. As well as some updates on the neuron project! Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter - https://twitter.com/glimsd?lang=en Scihouse discord - https://discord.gg/t6hJEVz Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody. Earlier videos: PCR - https://youtu.be/7kJ2o7P8D00 Gel Electrophoresis - https://youtu.be/sSKls2kNC4U ___________________________________________________________________ Try tab for a cause today: https://tab.gladly.io/thethoughtemporium/ ___________________________________________________________________ 00:00 - Introduction 04:00 - Virus Anatomy Overview 09:45 - PCR Overview 13:30 - Performing PCR 20:37 - Testing at Scale and Robots (Opentrons) 23:30 - LAMP overview 27:50 - Performing LAMP (Biofoundry) 30:30 - Pros/Cons of Genetic Tests 31:30 - Antibody Overview 32:50 - Performing Antibody Test 34:00 - How Antibody Tests Work 38:00 - Summary ___________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ ______________________________________________________________________ More resources, and citations: Kurzgesagt Covid Overview: https://youtu.be/BtN-goy9VOY A great writeup about the virus's anatomy: https://bit.ly/2FJq6G8 JOGL: https://app.jogl.io/program/opencovid19 Biofoundry: https://foundry.bio/ Student Outbreak: https://bit.ly/2Qa3vEq Student Outbreak 2: https://bit.ly/34hQgdl Strokes In heathy people: https://bit.ly/2QdQREK Organ Damage: https://bit.ly/3aHONhy Aptamer Tests: https://rsc.li/3j2Fb3I Variations in Test Accuracy: https://bit.ly/2YlojNV Faulty probes: https://bit.ly/3aIPlDJ Contaminated Swabs: https://bit.ly/34fnVEt False positives FDA: https://bit.ly/3gojBFv E protein structure: https://bit.ly/3aN5Yyb MERS fact sheet: https://bit.ly/2CLUaQn Incidence of thromboembolism: https://bit.ly/2YgiBgc Stroke study: https://bit.ly/2E59Pei Stroke 2: https://bit.ly/2Yk8yql Cardiac infection: https://bit.ly/3l5DaWo Asymptomatic infection rate: https://bit.ly/2YgiOju Asymptomatic infection study: https://go.nature.com/2CLO2rb Organ damage in asymptomatic pateints: https://bit.ly/2YfaMHJ Wisconsin LAMP trial: https://bit.ly/3aIQfA7 Healthy people stroke: https://bit.ly/2YmKEuB LAMP Assay design: https://bit.ly/3aJnqUv Mutation geneology: https://bit.ly/34hxqTs Cardiac outcomes: https://bit.ly/3hjJBmo False negative rate: https://bit.ly/3j47I95 ACE2 distribution: https://go.nature.com/3aJsMyR Long Haulers article: https://bit.ly/2EgU9nP Long haulers Video: https://youtu.be/AuKAg52mz4s Complete protein models: https://bit.ly/32akpIS Antibody test: https://bit.ly/2CIXT0S _________________________________________________________________________________ Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: http://binomicalabs.org/ SpikeF - AGGAATTTTTATGAACCACAAATCA MembraneR - CGGTGATCCAATTTATTCTGTAAAC NucleoF - AAATGAAAGATCTCAGTCCAAGATG NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT Original Primers: N1F - GACCCCAAAATCAGCGAAAT N2F - ttacaaacattggccgcaaa N3F - GGGAGCCTTGAATACACCAAAA N2R - GCGCGACATTCCGAAGAA N2-LF - gggggcaaattgtgcaatttg N2-B3 - gacttgatctttgaaatttggatct N2-F3 - accaggaactaatcagacaag

Today we're once again chatting with my friend Gabriel Licina. This time we're again talking about biology in space! They say space is the next frontier but without biology it'll remain a bunch of dead rocks. So today we cover ideas about terraforming, green space stations, growing food, mutant bacteria, human physiology and maybe even... aliens? Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter - https://twitter.com/glimsd?lang=en Scihouse discord - https://discord.gg/t6hJEVz Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're again talking about our favorite wonder material, chitosan! The second most abundant biopolymer on earth, chitosan can be used in seemingly endless ways. From bioplastics, to transfection agents, to water purification and more, there's few things chitosan can't do, and fewer projects that can't be improved through it's addition. Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter - https://twitter.com/glimsd?lang=en Scihouse discord - https://discord.gg/t6hJEVz Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're again talking about some of our favorite genetics projects and the organisms that resulted! Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter -https://twitter.com/glimsd?lang=en Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Several months ago I got an amazing new liquid handling robot which could make so many biology tasks faster and easier. But for various reasons I wasn't able to play with it much until now. The company recently updated their API to be more extensive so it seemed like a perfect opportunity to give it a whirl. Today we'll be learning how to program the robot and running some basic tests and protocols. Huge thanks to opentrons for this amazing machine! Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're again talking about his bee project and how he's using special bacteria to transfer neonicotinoid resistance to bees! Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter -https://twitter.com/glimsd?lang=en Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

This project was started last week and is a bit wild. A specific protein from malaria called var2csa was shown in various papers to preferentially stick to more than a dozen types of cancer while ignoring every other cell type. By combining the active part of the protein with the back half of an antibody, it turns the whole assembly into a potent synthetic anti-cancer antibody, which if given to a patient should trigger an antibody dependent cellular cytotoxic effect and eliminate the cancer cells without the need for traditional chemo/radiation. In this part we'll be going over some changes to the construct that'll make it more effective, talk more about how this works, and explore how pieces of DNA are ordered from synthesis companies. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

This one will be a bit wild. One malarial protein called var2csa has the weird ability to home to many different types of cancer and is being studied extensively to develop new tests are treatments. Today we'll be attempting to isolate the correct gene, then design a fusion protein that turns it into a sort of synthetic antibody. From there we'll take the newly designed protein and build it into a lentiviral plasmid for delivery. Lentivirus is the proper name for the HIV family of viruses which have been gutted to make them safe and useful for gene therapy. The idea is that if used on a patient it would attract the immune system to a tumor, effectively killing it without the need for chemotherapy. This is purely theoretical of course, but it's an interesting idea that I think is worth exploring. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today's video will be a bit different. I've needed a proper editing computer for years and today the last of the pieces for my first ever proper build arrived. Not having a proper rig has seriously limited what I can do with my videos so this massive upgrade will hopefully radically change how I make content. Come hang out as a new era of thought emporium video begins! Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Go to https://expressvpn.com/thoughtemporium and find out how you can get 3 months free. ________________________________________________________________________ Genetic Engineering is, amazing. In many previous videos we've explored the basics of how genetic engineering works, and today we'll be exploring something a little more complicated; engineering yeast to produce beta-carotene, the precursor for vitamin A. We'll then use these newly modified yeast to bake and brew with, giving the items we make a vitamin boost! Subscribe to Taste Emporium: https://www.youtube.com/c/thetasteemporium Igem Team: http://2011.igem.org/Team:Johns_Hopkins Original Paper: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1932764/ Merch: https://teespring.com/stores/the-thought-emporium PLATE solution recipe: 40% PEG3350 (w/v) 100 mM lithium acetate (LiAc) 10 mM Tris, pH 7.5 0.4 mM EDTA __________________________________________________________________________ Previous videos: Genetically modify Bacteria https://youtu.be/F0_q-fD_lyU Building an Incubator https://youtu.be/Zm378x6zJYc Spider Beer 1 https://youtu.be/Fx8TcGrCOSI DNA Extraction https://youtu.be/knosqmvLWSc Growth Media https://youtu.be/L0o51eco6Vg PCR https://youtu.be/7kJ2o7P8D00 Fluorescent Microscope https://youtu.be/iYoAiqufB7w Gel electrophoresis https://youtu.be/sSKls2kNC4U How DNA was Discovered https://youtu.be/4pRYHrPJ8Eo How to stock a genetics lab https://youtu.be/zqQ4x9rmkKg _______________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! Dan Heidel Chuck Pearce DL1JPH Juanacer John Hamann Joseph Catrambone Sean OCallaghan Daniel Smartt Dorin Meghesan Justa Noman Kristoffer Börebäck Kevin Amir Andrew Denton Diego Gondwana Sexbot Joshua King ACatThatIsAlsoACat Max Scop Littlenova Michelle Ramanovich Jordan Gonzalez Nicholas E. Smart karlicoss Brett Poole Nico Schlüter Enyo Jaravata Eric Brummer Hayden Norris Strange Mysteries joey garcia Ethan Roth Jeremy Sagnol Soeren Skov Andersen (DK) Justus Wingert modus_ponens Jack Paschke AKrumm81 Olaf 33 Micah Andrej Karpathy danruff5 Paul Klopping Rolf Reich Pedersen Adam Silver Erwan Martin BPS.space Neil Svedberg Leonid Usov Andrew Jewell Martin Kemka Dmitry Sadovnikov Mike Miller Paul Toensing Dean Pierce Owen Burns Owen Ashurst Rikki Guy Gal Tibi Rajan Chari Ruben Cronenberg Jerry Brad Walker Yannik Neuhaus Lee Goymer Toli Rae McIntosh Simon Convey Maxwell Jon Adams Tómas Árni Jónasson Michael Santiago Brady OBrien Marco Reps John Dave Yeagly Andy Krys Kamieniecki robert braun Nicholas Fletcher Alexander Marunowski Áva Eriksdóttir Harry Pottash Liam Scaife Ambrose Comrade Spamuel Chris the Mad Sciencer Chas Evans Meinhard Absalon Piper Elinor Louis Cashin TheOneTrueJames Jack Brown Luc Ritchie Matthew Reece-Ford Dustin Parciasepe Joshua Pedrick Vedran Bajic Ian Eugene Pakhomov xj9 Jeremy andrew james morris Andre emptymachine Leslie Rohde James Jaroslav Henner Monsyne Dragon Martin Haugsand Tiffany Bennett Filipsi Jonathan Dashe David Choitz Sebastiaan Schlappi Lambda GPU Workstations Matthew Broerman Sean Coates Leon Ezekiel Dohmen Kevin Forsythe Robert S. tain dstensnes Kevin TheQuickestBrownFox Pietro Saccardi Elliot Turner Danny Chan Patrick Sweetman Tom Bullock SkaveRat Alexander Eisele Paul Emmerich Bennet Huch Jase Smith Leon Schutte Sam Pinches Ben Reay Simon Hallam Michael Gregg Rauni Paul Richmond Jim Mussared besenyeim kn0tsin Afrotechmods Michael Chatzidakis Alexandre Guhur Applied Science Justin Hendryx John De Witt Jonas Abreu Anita Fowler Mohammad Ben Salamah Joshua Hill Hasanur Rashid Alexandra Crawford Piotr Emeschajmer Mason Acri Alptekin Aktürk Queilasha Chris Reichelt Robert Taylor kishan California Mist abhijith raghu jlawrence6809 NinguL Paul Roundfield Martin Moore Prithvi quantum Alberto Moga El Silva Danielle Questiaux Barbara Wulff Justin T Firth Sr Çağlan Turgut mgregggphone Jorm Skagh Jerry Dy Sam Weison stevenson primacio Nyarmith John Bushong Adel youtube Ryan Yosua Jamma McJammason jonesbs761 David Siriani Tihomir Nedev my name Richard Manion Chris Kosik Aziz Başkan Eric Reiter shreyas ubale Jacob Stewart Incognito AI Faris Faux Matt Ettler Chris Modjeska andré bernard mennicken Shwe Yin Aye Radio Astronomy (MSAS) Ajit A flantc GeneEditingDuringIQCrisisStrugglesToMakeProgress Jonathan Nagel István Kiss trevor skjerpen adamklam1 Anthony M Kush Agarwal

Today we're once again chatting with my friend Gabriel Licina. This time we're talking about all things fermented! From koji and miso, to beer, pickles, garum and more! Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter -https://twitter.com/glimsd?lang=en Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

This week we're looking at a fun bit of plant bioengineering and how it's possible to make tearless onions. All the same flavor, but none of the crying! Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're talking about all things plants! From various permaculture techniques, to our favorite plants, crops, and growing systems. Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter -https://twitter.com/glimsd?lang=en Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

After running a poll, this was the topic you all chose for todays stream! We'll be looking at the genetic modification of neurons to enable them to detect magnetic fields for navigation purposes, similar to how birds and sharks are able to navigate. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we'll be having a chat with a very special guest, Kevin Chen. His company, Hyasynth Bio, has been engineering a special strain of yeast to produce cannabinoids like THC and CBD as well as other valuable compounds. Based in canada, the work of his company is permitted under regulations. We'll be talking about how the technology works, why it's valuable, trends in the market, and lots more! Kevins links: Hyasynth Bio - https://hyasynthbio.com/ Linkedin - https://www.linkedin.com/company/hyasynth-biologicals/ Brico Bio: https://www.brico.bio/ Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're talking about ideas from our favorite bits of science fiction that could be real. SO maybe not star gates or warp drives, but rather neuron computers, carbon capture factories, and healing gel Gabriels links: Instagram - https://www.instagram.com/glimsd Website - http://scihouse.space/ Twitter -https://twitter.com/glimsd?lang=en Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I'll be picking a random idea out of a hat and then designing DNA to accomplish that idea. Title will be updated once an idea is chosen. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're talking about gorilla gardening and garduino robotic gardening. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Pre chosen topic this time. Gonna be doing some optogenetics stuff this time! Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I'll be picking a random and ridiculous idea out of a hat, and then researching and designing a DNA construct to accomplish it, LIVE! The topic will be chosen randomly from a hat which is filled from a list of potential ideas largely submitted by all of you. The stream name will be updated as soon as an idea is chosen. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we're once again chatting with my friend Gabriel Licina. This time we're talking about genetic engineering and how it can be used for climate change. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

A little over 2 years ago, my life changed when I took a home brewed gene therapy to attempt to get rid of my lactose intolerance. within days of taking the therapy I went from being violently ill if I ingested even the slightest hint of lactose, to being able to eat a quart of ice cream without so much as a second thought. So, how did it hold up? In this video I finally give an update, and talk about what future versions of the therapy may look like. Original Video: https://youtu.be/J3FcbFqSoQY Original paper: https://www.ncbi.nlm.nih.gov/pubmed/9771745 Chitosan paper: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4717060/?fbclid=IwAR0K7C8GounA9DZwkIRm8qSGMSKuo_uHsl8-2qd2fGjnIgn5SkPXddcODsY Whose gene github: https://github.com/thethoughtemporium/Whos-gene-is-it-anyway Playlist of live streams: https://www.youtube.com/playlist?list=PLZLsjPxmF1BEI5CReoklVP4u84kMkjIZp _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! ACatThatIsAlsoACat Adam Silver Afrotechmods AKrumm81 Alexander Eisele Alexander Marunowski Alexandre Guhur Ambrose Andre Andrei-Gabriel Andrei-Gabriel Andrej Karpathy andrew james morris Andrew Jewell Andy Anita Fowler Applied Science Ben Reay Bennet Huch besenyeim BPS.space Brad Walker Brady OBrien Brand Caso Brett Poole Chas Evans Chris the Mad Sciencer Comrade Spamuel Cronenberg Jerry Danny Chan danruff5 Dave Yeagly David Choitz Dean Pierce Dmitry Sadovnikov Drew DeVault dstensnes Dustin Parciasepe Elliot Turner emptymachine Enyo Jaravata Eric Brummer Erwan Martin Ethan Roth Eugene Pakhomov Ezekiel Dohmen Filipsi Gal Tibi Harry Pottash Hayden Norris ian burghardt Jack Brown Jack Paschke James Jaroslav Henner Jase Smith Jeremy Jeremy Sagnol Jim Mussared joey garcia John John De Witt Jon Adams Jonas Abreu Jonathan Dashe Jordan Gonzalez Joshua Pedrick Justa Noman Justin Hendryx Justus Wingert karlicoss Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda GPU Workstations Lee Goymer Leon Leon Schutte Leonid Usov Leslie Rohde Liam Scaife Littlenova Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Martin Kemka Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Michael Chatzidakis Michael Gregg Michael Santiago Michelle Ramanovich Mike Miller modus_ponens Monsyne Dragon Neil Svedberg Nicholas E. Smart Nicholas Fletcher Nico Schlüter Olaf 33 Owen Ashurst Owen Burns Patrick Sweetman Paul Emmerich Paul Klopping Paul Richmond Paul Toensing Pietro Saccardi Piper Elinor Rae McIntosh Rajan Chari Rauni Rikki Guy robert braun Robert S. Rolf Reich Pedersen Ruben Sam Pinches Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat Soeren Skov Andersen (DK) Strange Mysteries tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Todd Gore Toli Tom Bullock Tómas Árni Jónasson Vedran Bajic xj9 Yannik Neuhaus Áva Eriksdóttir mgregggphone Jorm Skagh Jerry Dy Sam Weison Tony Simpson tom300z stevenson primacio Mohammad Ben Salamah Nyarmith Christian Bastos John Bushong Adel youtube Matej Gagyi Ryan Yosua Jamma McJammason jonesbs761 David Siriani Tihomir Nedev Joseph Freeman my name Richard Manion Chris Kosik Aziz Başkan Eric Reiter shreyas ubale BasiC7786 Jacob Stewart Incognito AI abhijith raghu Faris Faux Matt Ettler Chris Modjeska andré bernard mennicken Shwe Yin Aye Radio Astronomy (MSAS) Ajit A Guillermo Alum flantc GeneEditingDuringIQCrisisStrugglesToMakeProgress Jonathan Nagel István Kiss txyzinfo trevor skjerpen adamklam1 Anthony M Kush Agarwal

Second attempt at a stream. I think I fixed the issue. Every year thousands of acres of crops are destroyed by various plant viruses, and as (bad) luck would have it, I get to experience them first hand thanks to some of my indoor plants getting infected. So today we're going to explore how scientists are developing vaccines against these terror and maybe just save my plants in the process. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I'll be picking a random and ridiculous idea out of a hat, and then researching and designing a DNA construct to accomplish it, LIVE! The topic will be chosen randomly from a hat which is filled from a list of potential ideas largely submitted by all of you. The stream name will be updated as soon as an idea is chosen. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

Today we'll be talking with biologist Gabriel Licina about his work on genetically modifying bees and trees. Papers and links: Fast growing trees - https://www.ncbi.nlm.nih.gov/pubmed/25866390 BEES - https://science.sciencemag.org/content/367/6477/573 Gabriel's Social media: Insta - https://www.instagram.com/glimsd/ Website - http://www.scihouse.space/ tiktok - glimsd Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium

In this new live stream format we'll be taking a break from the theoretical and diving into some hands on work in the lab. During one of the earlier live streams we had a donation goal set so I could buy a fluorometer and be able to accurately measure DNA. It's now arrived so today we're going to go through testing and calibrating it, and then quantifying all the DNA I have stored. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I'll be picking a random and ridiculous idea out of a hat, and then researching and designing a DNA construct to accomplish it, LIVE! The topic will be chosen randomly from a hat which is filled from a list of potential ideas largely submitted by all of you. The stream name will be updated as soon as an idea is chosen. PART 2: https://youtu.be/0VG9Ag5ZJyc (stream got cut off) Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I'll be picking a random and ridiculous idea out of a hat, and then researching and designing a DNA construct to accomplish it, LIVE! The topic will be chosen randomly from a hat which is filled from a list of potential ideas largely submitted by all of you. The stream name will be updated as soon as an idea is chosen. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I'll be picking a random and ridiculous idea out of a hat, and then researching and designing a DNA construct to accomplish it, LIVE! The topic will be chosen randomly from a hat which is filled from a list of potential ideas largely submitted by all of you. The stream name will be updated as soon as an idea is chosen. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/

I'll be picking a random and ridiculous idea out of a hat, and then researching and designing a DNA construct to accomplish it, LIVE! The topic will be chosen randomly from a hat which is filled from a list of potential ideas largely submitted by all of you. The stream name will be updated as soon as an idea is chosen. Donations: https://streamlabs.com/thethoughtemporium Github: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway Paper links: penicillin in yeast - http://europepmc.org/article/PMC/5418595 glowing plant - https://www.biorxiv.org/content/10.1101/809376v1.full.pdf _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium

I'll be picking a random and ridiculous idea out of a hat, and then researching and designing a DNA construct to accomplish it, LIVE! For this first stream the idea has been prechosen "growing milk and eggs without animals" but future streams will be random. Finished plasmids: https://github.com/thethoughtemporium/Whose-gene-is-it-anyway/tree/master/milk-and-eggs _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium

It may seem strange, but everything you've ever eaten contained a tiny amount of antimatter. In this video we explore how it's produced, what happens to it, and how we can detect it. We build a gamma ray spectrometer and use it to detect the antimatter in common materials. Gamma spectacular: https://www.gammaspectacular.com/blue/?tracking=5e4c4c2211ad2 Calibration sheet: https://github.com/FOULAB/photomultipliercalibration/blob/master/Thorium-linearity-check%20(1).xlsx PRA: https://www.gammaspectacular.com/marek/pra/index.html Previous video: https://youtu.be/C7TwBUxxIC0 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/emporiumthought Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! A_Demigod Adam Silver Afrotechmods AKrumm81 Alexander Eisele Alexander Marunowski Alexandre Guhur Ambrose Andre Andrei-Gabriel Andrei-Gabriel Andrej Karpathy andrew james morris Andrew Jewell Andy Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit bluejay BPS.space Brad Walker Brady OBrien Brand Caso Chris the Mad Sciencer Comrade Spamuel Cronenberg Jerry Dakramar Danny Chan danruff5 Dave Yeagly David Choitz Dean Pierce Dmitry Sadovnikov Drew DeVault dstensnes Dustin Parciasepe Elliot Turner emptymachine Erwan Martin ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Gal Tibi Harry Pottash Jack Brown Jack Paschke James Jaroslav Henner Jase Smith Jeremy Jim Mussared John John De Witt Jon Adams Jonas Abreu Jonathan Dashe Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda GPU Workstations Lee Goymer Leon Leon Schutte Leonid Usov Leslie Rohde Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Martin Kemka Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Micah Michael Chatzidakis Michael Gregg Michael Santiago Mike Miller Monsyne Dragon Neil Svedberg Nicholas Fletcher Nova Olaf 33 Owen Ashurst Owen Burns Patreon Patrick Sweetman Paul Emmerich Paul Klopping Paul Richmond Paul Toensing Pietro Saccardi Piper Elinor Rae McIntosh Rajan Chari Rauni Rikki Guy Robert Boll robert braun Robert Miller Robert S. Rolf Reich Pedersen Ruben Sam Pinches Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat tain Tajallah Sims TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Toli Tom Bullock Tómas Árni Jónasson Valery Belayev Vedran Bajic Virgil Ilian Walter Jones xj9 Yannik Neuhaus Áva Eriksdóttir Channel members: stevenson primacio Prithvi quantum Chris Kosik Aziz Başkan Eric Reiter shreyas ubale BasiC7786 Jacob Stewart Emi Li Incognito AI abhijith raghu Faris Faux Matt Ettler Chris Modjeska andré bernard mennicken Jose Ayala Shwe Yin Aye Radio Astronomy (MSAS) Ajit A Guillermo Alum flantc HeLikesItWhenYouSpreadThatConciseThesisOnTheTable Jonathan Nagel István Kiss Jorm Skagh txyzinfo trevor skjerpen adamklam1 Herbling Anthony M Kush Agarwal

Ads for negative ion products seem to be all over the place these days and they are all the rage with the "wellness" crowd. With wild claims of vague or impossible health benefits, most people chalk it up to just being a scam or just a harmless product designed to separate people from their money. But the reality is so much worse. Negative ions are a very real thing, but making them takes energy. So how do you make a piece of plastic bracelet keep producing negative ions forever? Well, you fill it with radioactive material. In this video we go through all of the testing I did over the last few months to determine what's in these products and if they're dangerous. Gamma spectacular: https://www.gammaspectacular.com/blue/?tracking=5e4c4c2211ad2 Check out Adam's stuff: https://twitter.com/nanographs _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! A_Demigod Adam Silver Afrotechmods Alexander Eisele Alexander Marunowski Alexandre Guhur Ambrose Andre Andrei-Gabriel Andrei-Gabriel Andrej Karpathy andrew james morris Andrew Jewell Andy Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit bluejay BPS.space Brad Walker Brady OBrien Brand Caso Chris the Mad Sciencer Comrade Spamuel Cronenberg Jerry Dakramar Danny Chan danruff5 Dave Yeagly David Choitz Dean Pierce Dmitry Sadovnikov Drew DeVault dstensnes Dustin Parciasepe Elliot Turner emptymachine Erwan Martin ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Gal Tibi Harry Pottash ian burghardt Jack Brown James Jaroslav Henner Jase Smith Jim Mussared John John De Witt Jon Adams Jonas Abreu Jonathan Dashe Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda GPU Workstations Lee Goymer Leon Leon Schutte Leonid Usov Leslie Rohde Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Martin Kemka Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Micah Michael Chatzidakis Michael Duran Michael Santiago Mike Miller Monsyne Dragon Neil Svedberg Nicholas Fletcher Owen Ashurst Owen Burns Patreon Patrick Sweetman Paul Emmerich Paul Klopping Paul Richmond Paul Toensing Philipp Weber Pietro Saccardi Piper Elinor Rae McIntosh Rajan Chari Ralph Dratman Rauni Rikki Guy Robert Boll robert braun Robert Miller Robert S. Rolf Reich Pedersen Ruben Sam Pinches Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat Stephen Anderson tain Tajallah Sims TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Toli Tom Bullock Tómas Árni Jónasson Valery Belayev Vedran Bajic Virgil Ilian Walter Jones xj9 Yannik Neuhaus Zwaluw Áva Eriksdóttir Channel members: Alpha Centuri Arda Arslan Chris Kosik Aziz Kavalcıoğlu Eric Reiter Paweł Michalak shreyas ubale BasiC7786 Jacob Stewart Mellonoma The Great Moritz Imen Emi Li Incognito AI abhijith raghu Faris Faux Matt Ettler Chris Modjeska andré bernard mennicken Jose Ayala Shwe Yin Aye Radio Astronomy (MSAS) stevenson primacio Ajit A Guillermo Alum flantc ProjectNightingaleForResponsibleMedicine Dr. Brandon Wiley Jonathan Nagel István Kiss Jorm Skagh txyzinfo trevor skjerpen adamklam1 Herbling Anthony M Kush Agarwal

Genetic modification sounds like something that would be very complicated and difficult to do but the reality is that couldn't be further from the truth. With the right tools and techniques it's something that can be done on your kitchen table if you really wanted. In this video we explore how bacteria can easily be modified to produce a range of fluorescent proteins and even bioluminesce. More resources: Building an incubator/heatblock - https://youtu.be/Zm378x6zJYc DNA Extraction - https://youtu.be/knosqmvLWSc Running a Gel - https://youtu.be/sSKls2kNC4U Building a Gel Doc - https://youtu.be/dSqt073HyE0 DNA transcription and translation - https://www.youtube.com/watch?v=itsb2SqR-R0 Spider silk project overview - https://youtu.be/Fx8TcGrCOSI Sebastians pages: Instagram - https://www.instagram.com/atinygreencell/ Bionomica labs - https://binomicalabs.org/ David: Channel - https://www.youtube.com/channel/UCftNyK6c9JdIFTQ2TLQqm_g Stores to buy reagents: http://bio-world.com/ https://www.phytotechlab.com/ https://www.goldbio.com/ https://www.carolina.com/ http://amino.bio/ https://www.addgene.org/ http://neb.com/ _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! Afrotechmods Alexander Eisele Alexander Marunowski Alexandre Guhur Ambrose Andre Andrei-Gabriel Andrei-Gabriel andrew james morris Andy Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit bluejay Brad Walker Brady OBrien Chris the Mad Sciencer Comrade Spamuel Cronenberg Jerry Danny Chan Dave Yeagly David Choitz Dean Pierce Dima Drew DeVault dstensnes Dustin Parciasepe Elliot Turner emptymachine ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Frank Gal Tibi Harry Pottash ian burghardt illia Jack Brown James Jaroslav Henner Jase Smith Jim Mussared John John De Witt Jon Adams Jonas Abreu Jonathan Dashe Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda GPU Workstations Lee Goymer Leon Leon Schutte Leslie Rohde Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Michael Chatzidakis Michael Duran Michael Smith Mike Miller Monsyne Dragon narvutar1324 Nicholas Fletcher Nico Schlüter Owen Ashurst Owen Burns Patreon Patrick Sweetman Paul Emmerich Paul Richmond Paul Toensing Philipp Weber Pietro Saccardi Piper Elinor Rae McIntosh Rajan Chari Ralph Dratman Rauni Rikki Guy Robert Boll robert braun Robert Miller Robert S. Ruben Sam Pinches sdrwer erwer Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat Slop Shop Stephen Anderson tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Toli Tom Bullock Tómas Árni Jónasson Valery Belayev Vedran Bajic Virgil Ilian Walter Jones xj9 Yannik Neuhaus Zwaluw Áva Eriksdóttir Channel members: Jeko Ddragon BasiC7786 Roman Cerny Jacob Stewart steven hammel Mellonoma The Great Paweł Michalak bitizen248 Moritz Imen Ainius Beriozovas Emi Li Incognito AI abhijith raghu Faris Faux Matt Ettler Chris Modjeska andré bernard mennicken Jose Ayala Shwe Yin Aye Radio Astronomy (MSAS) stevenson primacio Ajit A Guillermo Alum flantc ProjectNightingaleForResponsibleMedicine Dr. Brandon Wiley Jonathan Nagel István Kiss Jorm Skagh txyzinfo Robert Boll trevor skjerpen adamklam1 Herbling Anthony M Kush Agarwal

I love the holiday season but have never gotten to decorate a tree, so this year I thought I'd change that. I picked up a beautiful pine tree, and set about decorating it. First I genetically modified some E. coli to fluoresce under black light in a variety of colors. Then picked up some bioluminescent marine algae. In this video I go through how I used these different organisms to make some stunning decorations and decorate my tree. And while I decorate, I took some time to look back at some of my favorite projects from 2019 and talk a bit about all the exciting ones coming up in 2020! Taste Emporium: https://www.youtube.com/c/thetasteemporium Algae: https://pyrofarms.com/ Videos I mentioned: Cloud chamber - https://youtu.be/-Cu3wW8rNAs Spider Silk Overview - https://youtu.be/Fx8TcGrCOSI Glowing yeast - https://youtu.be/maWd_BemCMY Eggs Benedict - https://youtu.be/7cWke8jxQiI Ultrasonic Alcohol - https://youtu.be/YlQT4ptwLKs They sent me water instead of DNA - https://youtu.be/LOyBYEks550 Neuron - https://youtu.be/V2YDApNRK3g Meat berry - https://youtu.be/FaVHTd9Ne_s Cold Fire - https://youtu.be/jRZkrrcDKb0 Glowstick of Doom - https://youtu.be/-jb6bA55c-0 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! Afrotechmods Alex Alexander Marunowski Alexandre Guhur Ambrose Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Brady OBrien Chris the Mad Sciencer Comrade Spamuel Danny Chan Dave Yeagly David Choitz Dima Drew DeVault dstensnes Dustin Parciasepe Eisolu Elliot Turner emptymachine ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown James Jaroslav Henner Jase Smith Jim Mussared John John De Witt John Wlazlo Jon Adams Jonathan Dashe Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Michael Chatzidakis Monsyne Dragon narvutar1324 Nicholas Fletcher Nico Schlüter Overshafter Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Robert Boll robert braun Robert Miller Robert S. Sam Pinches sdrwer erwer Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Tómas Árni Jónasson Vedran Bajic Virgil Ilian Walter Jones xj9 Áva Eriksdóttir Chris Modjeska Phillip Johnson andré bernard mennicken Jose Ayala Shwe Yin Aye Malcolm Berkeley Louis St Pierre Radio Astronomy (MSAS) stevenson primacio John Emery Ajit A bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation Dr. Brandon Wiley Jonathan Nagel István Kiss Jorm Skagh txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

Neurons are amazing little microbes capable of learning and making decisions. Modern AI tries to take inspiration from living neurons, but why settle for the synthetic version? By growing human neurons directly connected to a computer it's possible to make a living AI of sorts capable of even complex tasks like flying a plane in a simulation. Today we explore our first attempt at doing exactly that. We cover building the first prototype multi electrode array, growing the neurons and attempting to take some readings from them. This is the first part of what will hopefully be a many part series, so stay tuned for updates! More reading/sources: Rat neuron video- https://www.youtube.com/watch?v=1w41gH6x_30 Rat neuron paper - https://philosophy.as.uky.edu/sites/default/files/Adaptive%20Flight%20Control%20With%20Living%20Neuronal%20Networks%20on%20Microelectrode%20Trays%20-%20De%20Marse%2C%20Dockendorf.pdf Multi electrode array fabrication - https://iopscience.iop.org/article/10.1088/0960-1317/23/9/097001/meta Previous videos: Meat berry - https://youtu.be/FaVHTd9Ne_s Magnetron build - https://youtu.be/Cyu7etM-0Ko Gabes Stuff: http://www.scihouse.space/ https://www.instagram.com/glimsd/ https://www.instagram.com/scihousejax/ https://www.cbc.ca/news/health/biohacking-glybera-lipoprotein-lipase-deficiency-lpld-million-dollar-drug-1.5274314 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! Afrotechmods Alex Alexander Marunowski Alexandre Guhur Ambrose Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Brady OBrien Chris the Mad Sciencer Comrade Spamuel Danny Chan Dave Yeagly David Choitz Dima Drew DeVault dstensnes Dustin Parciasepe Eisolu Elliot Turner emptymachine ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown James Jaroslav Henner Jase Smith Jim Mussared John John De Witt John Wlazlo Jon Adams Jonathan Dashe Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Michael Chatzidakis Monsyne Dragon narvutar1324 Nicholas Fletcher Nico Schlüter Overshafter Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Robert Boll robert braun Robert Miller Robert S. Sam Pinches sdrwer erwer Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Tómas Árni Jónasson Vedran Bajic Virgil Ilian Walter Jones xj9 Áva Eriksdóttir Chris Modjeska Phillip Johnson andré bernard mennicken Jose Ayala Shwe Yin Aye Malcolm Berkeley Louis St Pierre Radio Astronomy (MSAS) stevenson primacio John Emery Ajit A bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation Dr. Brandon Wiley Jonathan Nagel István Kiss Jorm Skagh txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

Thanks to the many satellites we've put into orbit over the years, there is an enormous amount of data available to us in real time these days. And hidden in all that data are some really amazing and interesting things to see. From high resolution time lapses of the sun, to real time images of the entire planet in a dozen wavelengths. And thanks to the immense archive of data, we can see how the world has changed over time more clearly than ever. _________________________________________________________________ Head over to https://teamtrees.org and lets end off the decade on a high note! Destins video: https://www.youtube.com/watch?v=7bsuXsxX950&t=587s Mark robers video: https://www.youtube.com/watch?v=U7nJBFjKqAY Mr beasts video: https://www.youtube.com/watch?v=HPJKxAhLw5I _________________________________________________________________ More resources and videos Previous videos: https://youtu.be/jGWFg7EDnyY https://youtu.be/cjClTnZ4Xh4 Solar Dynamics Observatory: https://sdo.gsfc.nasa.gov/data/ Satellite data services archive: http://inventory.ssec.wisc.edu/inventory/ RAMMB Slider: https://rammb-slider.cira.colostate.edu/ Zoom earth: https://zoom.earth/ Earth Engine Timelapse: https://earthengine.google.com/timelapse/ _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! Afrotechmods Alex Alexander Marunowski Alexandre Guhur Ambrose Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Brady OBrien Chris the Mad Sciencer Comrade Spamuel Danny Chan Dave Yeagly David Choitz Dima Drew DeVault dstensnes Dustin Parciasepe Eisolu Elliot Turner emptymachine ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown James Jaroslav Henner Jase Smith Jim Mussared John John De Witt John Wlazlo Jon Adams Jonathan Dashe Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Michael Chatzidakis Monsyne Dragon narvutar1324 Nicholas Fletcher Nico Schlüter Overshafter Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Robert Boll robert braun Robert Miller Robert S. Sam Pinches sdrwer erwer Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Tómas Árni Jónasson Vedran Bajic Virgil Ilian Walter Jones xj9 Áva Eriksdóttir Chris Modjeska Phillip Johnson andré bernard mennicken Jose Ayala Shwe Yin Aye Malcolm Berkeley Louis St Pierre Radio Astronomy (MSAS) stevenson primacio John Emery Ajit A bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation Dr. Brandon Wiley Jonathan Nagel István Kiss Jorm Skagh txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

Get 30% OFF your first bag of coffee with Trade Coffee when you click here http://bit.ly/tradethoughtemporium and use the coupon code THOUGHTEMPORIUM at checkout _________________________________________________________________ Alcohol is one of a small handful of products that actually get better with age. But the aging process is inherently very slow, so producers of of top quality beverages can charge a premium for their product. But what if you could age alcohol, and lots of other liquids in only a few minutes or hours instead of many years? Well, you can! Using ultrasound and wood chips made of used barrels, you can achieve a very similar effect to aging, in only a few minutes. Using a combination of ultrasound an aeration, you can make the same chemical reactions take place but in a much shorter time span. The technique is so powerful that many companies have begun to work it into their production runs to make new and interesting products. More reading: 10.1016/S0308-8146(02)00226-1 10.1016/j.foodchem.2004.07.027 10.1016/j.ultsonch.2016.11.031 http://whiskyadvocate.com/rapid-aging-whiskey-feature/ _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! Afrotechmods Alex Alexander Marunowski Alexandre Guhur Ambrose Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Brady OBrien Chris the Mad Sciencer Comrade Spamuel Danny Chan Dave Yeagly David Choitz Dima Drew DeVault dstensnes Dustin Parciasepe Eisolu Elliot Turner emptymachine ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown James Jaroslav Henner Jase Smith Jim Mussared John John De Witt John Wlazlo Jon Adams Jonathan Dashe Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Michael Chatzidakis Monsyne Dragon narvutar1324 Nicholas Fletcher Nico Schlüter Overshafter Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Robert Boll robert braun Robert Miller Robert S. Sam Pinches sdrwer erwer Sean Coates Sebastiaan Schlappi Simon Convey Simon Hallam SkaveRat tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Tómas Árni Jónasson Vedran Bajic Virgil Ilian Walter Jones xj9 Áva Eriksdóttir Chris Modjeska Phillip Johnson andré bernard mennicken Jose Ayala Shwe Yin Aye Malcolm Berkeley Louis St Pierre Radio Astronomy (MSAS) stevenson primacio John Emery Ajit A bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation Dr. Brandon Wiley Jonathan Nagel István Kiss Jorm Skagh txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

Go to https://nordvpn.org/thoughtemporium or use coupon code thoughtemporium to get 70% off and 2 months free and start protecting your privacy online today! _________________________________________________________________ Decellularization is a pretty strange process. Using a special type of soap, it's possible to remove all the cellular material from a piece of tissue, leaving only the connective proteins and polymers behind that normally hold the cells in place. It leaves you with something that looks like the starting material, but is really just an empty sponge called a scaffold. Doctors and scientists have been exploring this technique for many years because those empty scaffolds are extremely useful for cell culture. By seeding them with cells taken from a patient, it's possible to grow a brand new organ or tissue able to be transplanted into a patient, potentially saving their life. The same technique could even be used to make lab grown meat. Today we explore this amazing process and turn an ordinary grape, into meat. More reading: Review paper - https://onlinelibrary.wiley.com/doi/pdf/10.1111/tri.13462?fbclid=IwAR2w4VjbbFLCJ62m-LhgED4aTk9LhR_UHjHQC_ALw_Cb315N3vMSYWt7Jm8 Andrew Pelling papers - https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0097835 https://pubs.acs.org/doi/abs/10.1021/acsbiomaterials.8b00178 Gabriels stuff: http://www.scihouse.space/ https://www.instagram.com/glimsd/ _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members! Name Afrotechmods Alex Alexander Marunowski Alexandre Guhur Ambrose Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Brady OBrien Chris the Mad Sciencer Comrade Spamuel Danny Chan Dave Yeagly David Choitz Dima Drew DeVault Dustin Parciasepe Eisolu Elliot Turner emptymachine ethan lutz Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown James Jaroslav Henner Jase Smith Jim Mussared John John De Witt John Wlazlo Jon Adams Jonas Abreu Jonathan Dashe Jonathan Ström Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Krys Kamieniecki Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Marco Reps Martin Haugsand Matthew Broerman Matthew Reece-Ford Maxwell Meinhard Absalon Michael Chatzidakis Monsyne Dragon narvutar1324 Nicholas Fletcher Nico Schlüter Overshafter Ozark Martin Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Rhettson Powell Robert Boll robert braun Robert Miller Robert S. Sam Pinches sdrwer erwer Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat Steven Pitman tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Tómas Árni Jónasson Vedran Bajic Virgil Ilian Walter Jones xj9 Áva Eriksdóttir andré bernard mennicken Jose Ayala Shwe Yin Aye Malcolm Berkeley Louis St Pierre Radio Astronomy (MSAS) stevenson primacio John Emery Ajit A bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation crazd467 Dr. Brandon Wiley Alicia Aboucha-Visser Jonathan Nagel István Kiss Jorm Skagh txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

Titanium is a pretty fantastic materiel on it's own, but if you can coat things in it you can radically alter their properties. Or just make them super colorful. In several previous videos we've explored how to coat all sorts of things in a variety of metals and materials, but titanium was one of the few that refused to work no matter what we tried. In this video we've finally cracked it and using thermal evaporation manage to coat all sorts of things in titanium metal. First Sputtering Video: https://youtu.be/Cyu7etM-0Ko Second Sputtering Video: https://youtu.be/EMzRZ4gXQ-0 Bens system: https://youtu.be/Ds-jtwXbLAk?t=1 Sam Zeloofs Channel: https://www.youtube.com/user/szeloof https://en.wikipedia.org/wiki/Evaporation_(deposition) _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members: Afrotechmods Alex Alexandre Guhur Ambrose Andre Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Chris the Mad Sciencer Comrade Spamuel Danny Chan David Choitz Drew DeVault Dustin Parciasepe Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown Jacob Persi James Janette Edson Jaroslav Henner Jase Smith Jeff Evarts Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Jonathan Ström Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Maksym Zavershynskyi Martin Haugsand Matthew Broerman Matthew Reece-Ford Max Wraae Meinhard Absalon Melissa Soto Michael Chatzidakis mike buebe Monsyne Dragon narvutar1324 Nico Schlüter OmuN Overshafter Ozark Martin Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat Steven Pitman tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Vedran Bajic Virgil Ilian xj9 Áva Eriksdóttir bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation crazd467 Brandon Wiley Alicia Aboucha-Visser Benedikt Frenzel Jonathan Nagel István Kiss Jorm Skagh Felix Nica txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

An Asian twist on Eggs Benedict, this recipe is guaranteed to wow your brunch guests. Taken from the manga Shokugeki No Soma (food wars) the recipe deconstructs a classic Eggs Benedict to create something new. Shiso/kombu rice, grilled pork chop, deep fried egg, and a tangy hollandaise sauce made with yuzu kosho and soy sauce. The dish is rich, delicious and full of fun textures and flavors that all mesh together perfectly. _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members: Afrotechmods Alex Alexandre Guhur Ambrose Andre Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Chris the Mad Sciencer Comrade Spamuel Danny Chan David Choitz Drew DeVault Dustin Parciasepe Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown Jacob Persi James Janette Edson Jaroslav Henner Jase Smith Jeff Evarts Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Jonathan Ström Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Maksym Zavershynskyi Martin Haugsand Matthew Broerman Matthew Reece-Ford Max Wraae Meinhard Absalon Melissa Soto Michael Chatzidakis mike buebe Monsyne Dragon narvutar1324 Nico Schlüter OmuN Overshafter Ozark Martin Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat Steven Pitman tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Vedran Bajic Virgil Ilian xj9 Áva Eriksdóttir bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation crazd467 Brandon Wiley Alicia Aboucha-Visser Benedikt Frenzel Jonathan Nagel István Kiss Jorm Skagh Felix Nica txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

Giveaway: https://www.circuitspecialists.com/giveaway Circuit Specialists Sonoluminescence Page: http://tiny.cc/sonoluminescence _________________________________________________________________ Sonoluminescence is probably one of the coolest phenomena you'll come across and involves conditions that over a fraction of a millisecond swing from -269C degrees to upwards of 10000C. By trapping a bubble with ultrasound you can force it to expand and then suddenly contract and in the moment of peak compression out comes a flash of light. In this video we explore how you can easily recreate this effect with very minimal hardware, and some of the other times this effects shows up, like when a mantis shrimp punches things. Thisoldtony video - https://youtu.be/pFeek0a8s7Q Electroboom Vido - https://www.youtube.com/watch?v=9po11qjCWxA _________________________________________________________________ *More resources* I'm going to supply these primarily as a list of DOI numbers. While I can't for legal reasons suggest you use a website, which shall remain unnamed, to get access to these papers, you could do that. Or just google them. You do you. 10.1098/rsta.1999.0325  10.1515/zpch-1934-0137 10.1016/j.ultsonch.2016.06.013 10.1143/JJAP.49.07HE01 10.1016/j.ultsonch.2016.06.013 Massive review paper with tons of resources: https://asa.scitation.org/doi/full/10.1121/1.4929687 Bubble footage from UCLA Putterman labs. They do awesome work, check out their research: http://acoustics-research.physics.ucla.edu/sonoluminescence/ Mantis shrimp/pistol shrimp footage from BBC Earth Unplugged: https://www.youtube.com/watch?v=ti2Uoc1RXuQ&t=4s _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ Special thanks to my amazing patrons and channel members: Afrotechmods Alex Alexandre Guhur Ambrose Andre Anita Fowler Applied Science Austin Morris Ben Ben Reay Bennet Huch besenyeim BinarySplit Chris the Mad Sciencer Comrade Spamuel Danny Chan David Choitz Drew DeVault Dustin Parciasepe Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte Harry Pottash ian burghardt Jack Brown Jacob Persi James Janette Edson Jaroslav Henner Jase Smith Jeff Evarts Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Jonathan Ström Joshua Pedrick Justa Noman Justin Hendryx Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Liam Scaife Louis Cashin Luc Ritchie Maksym Zavershynskyi Martin Haugsand Matthew Broerman Matthew Reece-Ford Max Wraae Meinhard Absalon Melissa Soto Michael Chatzidakis mike buebe Monsyne Dragon narvutar1324 Nico Schlüter OmuN Overshafter Ozark Martin Patrick Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat Steven Pitman tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Vedran Bajic Virgil Ilian xj9 Áva Eriksdóttir bitizen248 Guillermo Alum flantc Gavin Lou just_noXi SheLovesItWhenYouPullOutThatPhenomenalDissertation crazd467 Brandon Wiley Alicia Aboucha-Visser Benedikt Frenzel Jonathan Nagel István Kiss Jorm Skagh Felix Nica txyzinfo Robert Boll trevor skjerpen adamklam1 Hunter Bagby Anthony M Kush Agarwal

Click https://skl.sh/thethoughtemporium to get your first 2 months FREE! _________________________________________________________________ Every time lightning strikes, a huge assortment of stuff is released. We're all familiar with the usual flash of light and sound, but what you probably didn't know is that lightning releases a huge burst of radio as well. This type of radio, known as VLF radio, is some of the strangest there is. By converting this radio directly to sound we hear a cacophony of sounds, from pops and click, to animal like chirps and even strange sci-fi sounding noises. There's lot of other phenomena that can also produce VLF radio like this and by learning what each sound is, and when to listen for them, you can learn a lot about what's going on on earth. More links: http://abelian.org/vlf/ http://theinspireproject.org/default.asp?contentID=3 http://microsferics.com http://www.auroralchorus.com/wr3gde.htm#sferics http://members.home.nl/fkooiman/lightning/index.htm#5 https://www.popularmechanics.com/space/solar-system/a26552/vlf-frequencies-affecting-space/ _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons and supporters for helping to make these video possible. Special thanks to: Afrotechmods Alex Alexandre Guhur Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit Cameron Hypes Chandra Yarlagadda Danny Chan David Choitz Drew DeVault Dustin Parciasepe Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte ian burghardt Jack Brown Jacob Persi James Janette Edson Jaroslav Henner Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Jonathan Ström Joshua Pedrick Justin Hendryx Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Louis Cashin Luc Ritchie Lucas Hoheisel Maksym Zavershynskyi Martin Haugsand Matthew Broerman Matthew Reece-Ford Max Wraae Meinhard Absalon Michael Chatzidakis mike buebe Monsyne Dragon narvutar1324 Nico Schlüter OmuN Overshafter Ozark Martin Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat Steven Pitman tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Vedran Bajic Virgil Ilian xj9 __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal Jason Clay Istvan Kiss

Dc sputtering magnetrons are about as close to real magic as you can get. They use a beautiful cloud of plasma to spray metal or inorganic materials at whatever object you want, coating it in that material. As such sputter coaters are at the heart of many of the manufacturing processes that make our modern world what it is. Not the least of which is many of the steps for making every chip in every device you've ever used. In the last video we built a prototype sputter coater, but it was never meant as more than that. In this video we go through the upgrades that have been made to the machine and then put it through it's paces to cover basically everything we could find in various metals and metal oxides. The result is many stunning pieces of intricate metal or metalized objects. If you haven't seen it yet here's a link to the last video so you can see exactly how the machine works: https://www.youtube.com/watch?v=Cyu7etM-0Ko Giveaway link: http://tiny.cc/goldenhand Some more Resources -Applied Science's video - https://www.youtube.com/watch?v=9OEz_e9C4KM&t=1s -Sputtering yield rate chart - http://www.semicore.com/reference/sputtering-yields-reference -Building scientific apparatus - https://www.amazon.com/Building-Scientific-Apparatus-John-Moore/dp/0521878586/ref=sr_1_1?crid=2EMMO60ZRXGTX&keywords=building+scientific+apparatus&qid=1565237511&s=gateway&sprefix=building+scien%2Caps%2C204&sr=8-1 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons and supporters for helping to make these video possible. Special thanks to: Afrotechmods Alex Alexandre Guhur Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit Cameron Hypes Chandra Yarlagadda Danny Chan David Choitz Drew DeVault Dustin Parciasepe Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank genuinebyte ian burghardt Jack Brown Jacob Persi James Janette Edson Jaroslav Henner Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Jonathan Ström Joshua Pedrick Justin Hendryx Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde Lewis Westbury Louis Cashin Luc Ritchie Lucas Hoheisel Maksym Zavershynskyi Martin Haugsand Matthew Broerman Matthew Reece-Ford Max Wraae Meinhard Absalon Michael Chatzidakis mike buebe Monsyne Dragon narvutar1324 Nico Schlüter OmuN Overshafter Ozark Martin Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Piper Elinor Ralph Dratman Rauni Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat Steven Pitman tain TheOneTrueJames TheQuickestBrownFox Tiffany Bennett Tom Bullock Vedran Bajic Virgil Ilian xj9 __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal Jason Clay Istvan Kiss

Even though you may not be familiar with them, magnetrons are at the heart of many of the manufacturing processes that make the modern world what it is. They let you coat anything in either a layer of metal or ceramic, so they find heavy use in the semiconductor manufacturing industry and many others. From mirrors, to filters, to microchips and neural lace, these machines capabilities are truly amazing. I've been trying to build such a machine for years, so I'm excited to share my build of a functional magnetron that can successfully coat glass in a perfect copper mirror or metal oxide coating. More resources: Bens Video - https://www.youtube.com/watch?v=9OEz_e9C4KM&t=1s Why is titanium colorful? - https://www.youtube.com/watch?v=O2RaIJhZ81I Sputtering - https://en.wikipedia.org/wiki/Sputtering dichroic mirrors - https://en.wikipedia.org/wiki/Dichroic_filter _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons and supporters for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexandre Guhur Anatoly Bazarov Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit Cameron Hypes Danny Chan David Choitz Drew DeVault Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank,patreon ian burghardt illia James Jaroslav Henner Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Justin Hendryx Jörg Ehrig Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde9 Lewis Westbury Maksym Zavershynskyi Martin Haugsand Matthew Broerman Michael Chatzidakis Monsyne Dragon Moto narvutar1324 Nico Schlüter Noah Pedersen OmuN Ozark Martin Parker Ferguson Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Ralph Dratman Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat tain TheQuickestBrownFox Tiffany Bennett Tom Bullock Virgil Ilian xj9 __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal Jason Clay Istvan Kiss

One of the many reasons titanium is an amazing material is because of the beautiful colors that can be formed on it's surface by either heating it up or using a bit of electricity. But titanium dioxide is just a white powder so how does having a thin layer of it on the metal lead to rainbow colors? The answer not only explains why titanium is colorful, but also why oil films and bubbles look iridescent as well! Today we go through my process for making these stunning chopsticks, and then deep dive into the quantum mechanics that make those colors form. Links: Cold Fire: https://www.youtube.com/watch?v=jRZkrrcDKb0 Gecko Tape: https://www.youtube.com/watch?v=vpTX32KdVBQ Frosting Robot: https://www.youtube.com/watch?v=pC4kWF_acNI&t=1s Laser Table: https://www.youtube.com/watch?v=ML4FHNGzAn0&t=3s Microfluidics: https://www.youtube.com/watch?v=eNBg_1GPuH0&t=3s Veritasiums video: https://www.youtube.com/watch?v=Iuv6hY6zsd0 More reading about thin film optics: -https://en.wikipedia.org/wiki/Thin-film_interference -https://opentextbc.ca/physicstestbook2/chapter/thin-film-interference/ -https://en.wikipedia.org/wiki/Thin-film_optics _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons and supporters for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexandre Guhur Anatoly Bazarov Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit Cameron Hypes Danny Chan David Choitz Drew DeVault Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank,patreon ian burghardt illia James Jaroslav Henner Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Justin Hendryx Jörg Ehrig Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde9 Lewis Westbury Maksym Zavershynskyi Martin Haugsand Matthew Broerman Michael Chatzidakis Monsyne Dragon Moto narvutar1324 Nico Schlüter Noah Pedersen OmuN Ozark Martin Parker Ferguson Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Ralph Dratman Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat tain TheQuickestBrownFox Tiffany Bennett Tom Bullock Virgil Ilian xj9 __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal Jason Clay Istvan Kiss

If you've ever been decorating a cake, you know that accurately dispensing icing can be tricky. Well like all things, with a little bit of science and engineering, it's possible to make a robot to do this tricky job for you. The real star of the video is the syringe pump that makes this work. I've needed one for a while for a variety of projects, but all those projects are expensive and fiddly to get working, so I realized the icing was the perfect material to test the system. And once you're dispensing icing with a robot, it's only responsible to strap it onto a CNC machine and print some designs. Resources: 3d files: https://thingiverse.com/thing:3513428 Code: https://github.com/FOULAB/Icing-machine/tree/master Arduino: https://www.amazon.ca/gp/product/B01EWOE0UU/ref=ppx_yo_dt_b_asin_image_o03_s00? Easy driver: https://www.amazon.ca/gp/product/B0156C5COU/ref=ppx_yo_dt_b_asin_image_o03_s00 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons and supporters for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexandre Guhur Anatoly Bazarov Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit Cameron Hypes Danny Chan David Choitz Drew DeVault Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank,patreon ian burghardt illia James Jaroslav Henner Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Justin Hendryx Jörg Ehrig Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde9 Lewis Westbury Maksym Zavershynskyi Martin Haugsand Matthew Broerman Michael Chatzidakis Monsyne Dragon Moto narvutar1324 Nico Schlüter Noah Pedersen OmuN Ozark Martin Parker Ferguson Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Ralph Dratman Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat tain TheQuickestBrownFox Tiffany Bennett Tom Bullock Virgil Ilian xj9 __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal Jason Clay Istvan Kiss

Maybe you like lasers, or maybe you just want the cleanest sounding record ever, eitherway isolation tables are an essential tool. They stop all the noise and vibrations from the surrounding environment from getting into whatever delicate setup happens to be on them. I wanted one for a variety of reasons, but the main one discussed in this video is for the creation of holograms. Delrin: https://www.amazon.ca/gp/product/B000FN15T2 Magnets: https://supermagnetman.com/collections/rings-18mm-19-9mm/products/r1021?variant=11410340163 Steel Rods: https://www.amazon.ca/gp/product/B00KHUR5AQ Gecko tape: https://youtu.be/vpTX32KdVBQ Interferometer: https://youtu.be/VvdnZn2GDVw Spectrometer: https://youtu.be/pIk8I10ZmYY Optical chocolate by Tech Ingredients: https://www.youtube.com/watch?v=SoTi0tM4yQ8 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons and supporters for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexandre Guhur Anatoly Bazarov Andre andrew james morris Anita Fowler Applied Science Austin Morris Ben Reay Bennet Huch besenyeim BinarySplit Cameron Hypes Danny Chan David Choitz Drew DeVault Elliot Turner emptymachine Eugene Pakhomov Ezekiel Dohmen Filipsi Frank,patreon ian burghardt illia James Jaroslav Henner Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Dashe Justin Hendryx Jörg Ehrig Kevin Kevin Forsythe kn0tsin Lambda AI Hardware Leon Leon Schutte Leslie Rohde9 Lewis Westbury Maksym Zavershynskyi Martin Haugsand Matthew Broerman Michael Chatzidakis Monsyne Dragon Moto narvutar1324 Nico Schlüter Noah Pedersen OmuN Ozark Martin Parker Ferguson Patrick Sweetman Paul Emmerich Paul Richmond Phelan O'Connell Philipp Weber Pietro Saccardi Ralph Dratman Rhettson Powell Robert Boll Robert Miller Robert S. Sean Coates Sebastiaan Schlappi Simon Hallam SkaveRat tain TheQuickestBrownFox Tiffany Bennett Tom Bullock Virgil Ilian xj9 __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal Jason Clay Istvan Kiss

Singlet oxygen is a special excited version of normal molecular oxygen. In solution two singlet oxygen molecules crash into each other and release a flash of light which we see as a red glow. Today we explore two variants of a reaction that can produce this special excited state in what ends up being the worlds scariest glow stick reaction and an interesting example of luminescence that doesn't use a fluorescent dye. Outside of this reaction, singlet oxygen is something that's pretty pervasive in the natural world. Lots of compounds when exposed to light will convert normal oxygen to the singlet form. It also is one of the main reactive oxidant species that antioxidants in healthy foods protect against as it forms in our bodies. A HUGE thank you to NileRed as this video wouldn't have been possible without him. If you aren't already, go subscribe to his channel, it's amazing! https://www.youtube.com/user/TheRedNile _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal L Weiner

We are constantly bathed in a sea of particles of radiation but have no mechanism naturally to detect it. So it goes essentially unnoticed. But using only computer parts and stuff from the dollar store, it's possible to build a machine that can turn this invisible radiation visible and let us see particles come streaming off of radioactive material. That device is a cloud chamber. This is a fun one day build if you have the right materials and these devices are mesmerizing to watch as naturally occurring particles zip through the chamber leaving trails of fog in the wake. Some more resources: Cloudylabs - https://www.youtube.com/watch?v=XGNvAEtYZkw Info about radiation - http://www.world-nuclear.org/nuclear-basics/what-is-radiation.aspx Another build that uses a single cascaded peltier - https://www.instructables.com/id/Peltier-Cooled-Cloud-Chamber/ Materials: Peltiers - (100W) https://www.amazon.ca/TEC1-12710-Thermoelectric-Cooler-Peltier-154Wmax/dp/B01M0L8ABM (60w) https://www.amazon.ca/gp/product/B0087X728K/ref=ppx_yo_dt_b_asin_title_o00_s00?ie=UTF8&psc=1 Heatsink - https://www.amazon.ca/Cooler-Master-Hyper-212-RR-212E-20PK-R2/dp/B005O65JXI/ref=sr_1_3?keywords=heat+sink&qid=1558793473&s=gateway&sr=8-3 Thermal paste - https://www.amazon.ca/gp/product/B0087X728K/ref=ppx_yo_dt_b_asin_title_o00_s00?ie=UTF8&psc=1 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal L Weiner

Gecko are amazing creature that have an incredible climbing ability thanks to the use of nano structures on their feet. Scientists have since replicated these structures artificially and made rolls of tape with the same magical sticky properties are a gecko foot. But making these tapes is normally and expensive and difficult undertaking. In this video we explore a simple method to make gecko tape that if made correctly could hold upwards of 100 lbs. Bens Video: https://www.youtube.com/watch?v=9XQfYKYO380 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Jorm Skagh Ana Kasbar Jason Clay Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal L Weiner

Plasma is the 4th state of matter and it comes in many flavors. You probably know it from it's greatest hits, fire and lightning, but there is a lot more to plasma than most people are aware of. Cold plasma is my personal favorite as it has the same beautiful glow that all plasma have, but it's no warmer than room temp and feels cold to the touch. In this video we go through my year long journey to harness this weird state of matter into a torch that can be used for future experiments and in the lab. _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Jeff Xu Felix Nica txyzinfo Robert Boll ikereku trevor skjerpen Kiran Gupta adamklam1 Hunter Bagby Anthony M Kush Agarwal L Weiner

Microfluidics is the study and construction of collections of tiny fluid channels that can accomplish an incredible array of tasks; from simple mixing, to math and computer logic. But making the flow cells that make use of the principles of microfluidics is normally expensive due to material and equipment costs. In this video we explore a dirt cheap method for making very high quality microfluidic low cells, including one of the worlds smallest tesla valves, and a device meant to isolate cancer cells from a blood sample. SVGs: https://github.com/FOULAB/microfluidic-shrinky-dinks Papers: Shrinky dink 1: https://www.researchgate.net/publication/5753844_Shrinky-Dink_microfluidics_Rapid_generation_of_deep_and_rounded_patterns Shrinky dink 2: https://www.ncbi.nlm.nih.gov/pubmed/18094775 Blood spiral: https://www.ncbi.nlm.nih.gov/pubmed/26678083 Images from papers: PCR lab on a chip: http://advances.sciencemag.org/content/advances/3/3/e1501645.full.pdf Octobot: https://www.youtube.com/watch?v=CDohWwEXQ68 Microfluidic cell separation: https://www.researchgate.net/figure/Microfluidic-cell-separation-and-processing-methods-a-Microfilter-designs-of-Weir-type_fig13_313874117 Review of microfluidic separation and filtration: http://sci-hub.tw/10.1007/978-981-10-5394-8_3 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join Store: https://teespring.com/stores/the-thought-emporium _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: ikereku trevor skjerpen Kiran Gupta adamklam1 martincodyre Hunter Bagby Anthony M Kush Agarwal L Weiner

It's been a very busy few weeks in the lab with lots of projects getting moved forward. However due to an issue with my ecoli, some of the projects which were supposed to be finished by now have to be temporarily put on hold as I wait for new supplies. So in this video we go through all the various projects we've been working on, as well as what's coming up during the summer. We cover a many topics including microfluidics, radio, and lots of biology. _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby martincodyre adamklam1 Kiran Gupta trevor skjerpen

Fluorescent microscopy was always one of my favorite parts of working with mammalian cells as it always made for spectacular images. There are a variety of techniques that make use of fluorescence microscopy, many of which are used regularly in the best labs in the world. But fluorescence microscopes themselves come with a steep price tag long before you think about reagents. Over the last few months I've been exploring how to convert a cheap OMAX entry level microscope into a fully functional fluorescence scope which I'm happy to report was a huge success. The mod uses a 5mw laser and a special but readily available filter and produces stunning images on par with some of the commercial models. This is the filter I used: https://www.ebay.ca/itm/RGB-System-Optics-Reflect-Blue-Laser-pass-Green-and-Red-laser-lens-15x15mm-1pcs-/141138532598?hash=item20dc8318f6&_uhb=1 If this link stops working just search "reflect blue pass green and red" on ebay and it should come up. Currently it costs ~5 dollars. When I recorded this script I thought it was ten. So total mod cost 7 whole dollars. 5 for this filter, 2 for the laser. _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby martincodyre adamklam1 Kiran Gupta trevor skjerpen

In this video we build the main piece of a simple rotovap system. Rotovaps are a more advanced but also more specialized form of distillation where gentle heat, rotation and vacuum is used to remove solvents from things that are otherwise too delicate to heat beyond lukewarm. They're used in industry and in labs often and they're the idea tools for concentrating biological materials like chitosan or silk solutions which would burn or degrade if normal distillation was used. Other times rotovaps are used for drying stubborn compounds like fluorescein which are notoriously hard to dry. The coupling we make is able to rotate freely, while maintaining the internal system under vacuum. It's made of a rod of solid teflon in a wooden support. _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby martincodyre adamklam1 Kiran Gupta

Meat glue tends to get a bit of a bad rap, and if you were to believe the mommy blogs it's the scariest of the food additives. Meat glue, whose proper name is transglutaminase is a natural enzyme isolated from one of several species of bacteria. Its job is to stick any proteins together that contain glutamine or lysine amino acids. That's not to say bacteria are the only source as YOU are full of the enzyme as well and your body uses it to hold different proteins together. In the culinary world meat glue has an enormous number of uses and today we explore 3 simple recipes that highlight some of these. However it's also very useful in a laboratory setting which will be the topic of a future video. 3d bioprinting paper: https://www.frontiersin.org/10.3389/conf.fbioe.2016.01.01924/event_abstract Meat glue sushi: https://www.youtube.com/watch?v=isdfF2qk5Qw Molecular gastronomy course: https://www.youtube.com/watch?v=McjrzC6KNSo _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby martincodyre adamklam1 Kiran Gupta

The natural world is full of colorful molecules, but few have been used by biologist more than green fluorescent protein and it's beta barrel relatives. Fluorescent proteins come in a literal rainbow of colors and can be both natural and/or artificial in origin. Last week we built an awesome little bioreacotr and with it we grew 400ml of E coli that produce a cousin of GFP, Red Fluorescent Protein. In this video we go through the basics of protein extraction and show how you go from growth media to final product. I'll be sending a sample of the purified extract to Nurdrage so he can test and see if fluorescent proteins are viable dyes for glowstick chemistry. We're not expecting it to be very good, but even a flash of light for a moment would be very interesting. Lantern: https://www.youtube.com/watch?v=l_b0SCabjvo GFP Mead: https://www.youtube.com/watch?v=LOyBYEks550 Ultrasound: https://www.youtube.com/watch?v=iRh2oeB2OhQ Sebastian's Page: https://www.instagram.com/atinygreencell _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby

Bioreactors are very simple, but extremely useful devices. They're basically a large tank that microorganisms can be grown in, but what makes them special is their ability to grow a nearly infinite amount of the organism or a product an organism produces by slowly feeding in fresh nutrients and pulling out small amounts of product. They can also be used for directed evolution experiments, and so much more. I wanted one for all of these reasons and more, but also so that I had a nice visual to talk about the many bioluminescent microbes I've collected. So in this video we go through the process of turning a kerosene storm lantern into a bioreactor. In a future video we'll build a pumping and heating unit to accompany the build to make this into a fully capable bioreactor. For the first test I grew some E. coli that produce red fluorescent protein and after only a few days of growth the color was clear to see. David Ishee's channel: https://www.youtube.com/channel/UCftNyK6c9JdIFTQ2TLQqm_g Spider Silk Playlist: https://www.youtube.com/watch?v=Fx8TcGrCOSI&list=PLZLsjPxmF1BE48luRPtRu39OT4xc5Ak09 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby

Get your first audiobook free when you try Audible for 30 days. Visit https://www.audible.com/thoughtemporium or text thoughtemporium to 500 500 to get started today! _________________________________________________________________ When you think of ultrasound, the first things that probably come to mind are baby scans and denture cleaners. But ultrasonics is a massive and fascinating field with so much more capability than just cleaning. From sonic knives to sonic welding, all it takes is a bit of sonic power to make materials behave in really strange but useful ways. Today we build one such device which is an ultrasonic homoginizer. These are great little tools for popping open cells or mixing samples quickly, and can be used to make interesting emulsions as well as luminescent light if you get everything just right. This was my first metal lathe project and I've got to say I absolutely loved it! I'm very exciting for lots more machining videos in the future. _________________________________________________________________ Lindsay Wilson "tuning ultrasonic horns" - https://www.youtube.com/watch?v=-E7zlQEk5MA&t=1s This Old Tony Knife - https://www.youtube.com/watch?v=pFeek0a8s7Q Sonic Welding - https://www.youtube.com/watch?v=bZkhuhjPp7Q _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby

Spectrometers are one of the most ubiquitous tools in most labs because an enormous amount of information about a substance can be gleaned from how it interacts with various parts of the electromagnetic spectrum. But for as common as they are, the price tag on a new spectrometer can be massive. Today we go through a bit of theory on the electromagnetic spectrum so we understand spectrometery, and then build a little nanodrop-esq spectrometer for use in the lab. While it's still a work in progress, it's more than sufficient to preform many basic tests and experiments. Applied science Zeeman effect: https://www.youtube.com/watch?v=OzkcB1lkgGU Hackteria: https://hackteria.org/wiki/DIY_NanoDrop SVG file of design: https://github.com/FOULAB/DIYnanodrop/blob/master/DIYNanoDrop.svg Webcam: https://www.amazon.ca/AUSDOM-1920x1080P-Noise-cancelling-Recording-Computer/dp/B017SRHRR6/ref=sr_1_7?crid=8KPDXFH5IJ93&keywords=hd+webcam&qid=1547857754&sprefix=hd+web%2Caps%2C175&sr=8-7 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby

Go to http://ow.ly/vjyZ30n4UsI to start your free trial of the Great Courses Plus today! _________________________________________________________________ DNA extraction is easily one of the most common procedures in a genetics laboratory. Maybe we want to isolate a new gene from some organism, or we just want more of a plasmid we designed. No matter what chances are you'll use a column based method. Today we explore the basics of column DNA extraction and look at 2 different kits for 2 different DNA sources and explore why they're different. _________________________________________________________________ Nilered's video: https://youtu.be/araeHtN_3Lk _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ The Great Courses Plus is currently available to watch through a web browser to almost anyone in the world and optimized for the US, UK and Australian market. The Great Courses Plus is currently working to both optimize the product globally and accept credit card payments globally. _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica L Weiner Kush Agarwal Anthony M Hunter Bagby

It's been a crazy year so this week I wanted to take some time to look back on the past year and everything that was accomplished. A lot of amazing projects were completed this year and many of them have set the stage for even greater projects in the new year! There was far too many to cover for one video, so I just covered some of my favorites and some of the most popular from the last year. Videos I mentioned: Freeze dryer - https://www.youtube.com/watch?v=obhYSf1ogoo Cryogels - https://www.youtube.com/watch?v=R3QOBxpe3Gw T Cells - https://www.youtube.com/watch?v=Op3r_dB3ISk Lactose - https://www.youtube.com/watch?v=J3FcbFqSoQY Orcein - https://www.youtube.com/watch?v=4pRYHrPJ8Eo Plants - https://www.youtube.com/watch?v=JKz3t1I6MAk Polarized Light Microscope - https://www.youtube.com/watch?v=Knb8LzGmh6E Fly Pictures - https://www.youtube.com/watch?v=3wfI_rEGyDw Wifi Camera - https://www.youtube.com/watch?v=g3LT_b6K0Mc Pipsqueak - https://www.youtube.com/watch?v=smWwjiOIAYI GOES 16 Satellite Images - https://www.youtube.com/watch?v=jGWFg7EDnyY Bio Lab Build - https://www.youtube.com/watch?v=eoyXKJxQYCA Spider Silk Intro - https://www.youtube.com/watch?v=Fx8TcGrCOSI _________________________________________________________________Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica Christian Bastos L Weiner Kush Agarwal Anthony M Hunter Bagby

When it comes to gel electrophoresis, the only thing more frustrating than running a gel, is trying to see the result afterwards. Our caveman eyeballs just aren't sufficient for picking up the tiny amount of light coming off of a given sample. The solution to this problem? A gel doc. Normally gel imaging systems cost at least 8-12 thousand dollars, but there's no reason to spend that sort of cash. With nothing but a simple wooden box, and filter you can make your own gel doc for less than 100 dollars. This is one of those tools that when you get into molecular biology you learn to love as it makes your work look more professional, but also makes it a lot easier to see what's going on. Nerd Thunder Links: Jeri Ellsworth - https://www.youtube.com/user/jeriellsworth David Ishee - https://www.youtube.com/channel/UCftNyK6c9JdIFTQ2TLQqm_g/videos Tech ingredients - https://www.youtube.com/user/TechIngredients _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Alex Vanderpot Alexander Halbleib Alexandre Guhur Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daniel Gunn David Golouski Ezekiel Dohmen Elliot Turner Frank Harlad Havana Woody Jase Smith John De Witt Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford Kevin Forsythe kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Peter Scott Philipp Weber Pietro Saccardi Rauni Robert S. Ryan Harvey Simon Hallam Skave Rat Tom Bullock tain TheQuickestBrownFox Vasilis Whence __________ Channel Members: Felix Nica Christian Bastos L Weiner Kush Agarwal Anthony M Hunter Bagby

Growing fungi is becoming a more common hobby and lots of folks have even turned it into a career. Gourmet and edible fungi are actually very straight forward to grow and getting started is easy with the right materials. In this workshop and lecture participants got to make their own media and inoculate it before taking it home to fruit. I also gave a lecture on all things fungi covering: What are fungi, the main families, the basic life cycle, lots about how to grow fungi, and so much more! Some images courtesy of Ready-2-Fruit Mushrooms: www.ready2fruitmushrooms.com Here are some more great resources to help you get started and to learn more: https://www.amazon.ca/Growing-Gourmet-Medicinal-Mushrooms-Stamets/dp/1580081754 https://www.amazon.ca/Mycelium-Running-Mushrooms-Help-World/dp/1580085792 https://fungi.com/blogs/articles/the-petroleum-problem https://en.wikipedia.org/wiki/Panellus_stipticus _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Vanderpot Alexander Halbleib Alexandre Guhur Anatoly Bazarov Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daneil Gunn David Golouski Elliot Turner Frank Felix Nica Harlad Ian Tosta Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Philipp Weber Pietro Saccardi Rauni Simon Hallam Skave Rat Tom Bullock TheQuickestBrownFox Vasilis

Gel electrophoresis is one of the most ubiquitous techniques in molecular biology for 2 reasons; it's easy, and extremely versatile. We've used it several time over the past couple months to test various part of our ongoing spider silk project, so in this video we explore it in detail. First we build a gel box for only a couple dollars and then go through the process of making the gel, loading it up, running it and then explore how to analyze the results. We focus on DNA and agarose based gels and will come back to protein and acrylamide gels in a future episode. This video is meant to be the foundation on which we build so that in future episodes we can use gels as part of more complex techniques. If this is the first time you're seeing one of these biology videos you may be wondering what's going on. Well this playlist contains all of the work we've done over the last couple months and will continue to be added to as we make more progress. https://www.youtube.com/playlist?list=PLZLsjPxmF1BE48luRPtRu39OT4xc5Ak09 _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://teespring.com/stores/the-thought-emporium Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Vanderpot Alexander Halbleib Alexandre Guhur Anatoly Bazarov Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daneil Gunn David Golouski Elliot Turner Frank Felix Nica Harlad Ian Tosta Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Philipp Weber Pietro Saccardi Rauni Simon Hallam Skave Rat Tom Bullock TheQuickestBrownFox Vasilis

Starting a new lab is always a mix of exciting. On the one hand it means new equipment and materials, and setting up a lab is fun. But on the other hand the thought of paying for all those materials can seem daunting. Biology is a rather new field for citizen scientists to take up and so this video is meant to serve as a getting started guide so you know what's worth buying off the bat and what sort of materials you'll need to collect. While the list is a bit long, it doesn't take that long to collect everything. It's best to start small and slowly grow your collection as you do more projects. One thing I didn't mention in the video. Kits. Most reagents come as systems in a kit. DNA extraction kits are one example and they come with special tubes and all of the different solutions needed to use the system. Because of the sheer variety of kits I omitted that from the video and will mention it whenever I use one. _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Vanderpot Alexander Halbleib Alexandre Guhur Anatoly Bazarov Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daneil Gunn David Golouski Elliot Turner Frank Felix Nica Harlad Ian Tosta Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Philipp Weber Pietro Saccardi Rauni Simon Hallam Skave Rat Tom Bullock TheQuickestBrownFox Vasilis

Learn the basics of biology and some real lab skills. slides: https://docs.google.com/presentation/d/1CWQ285L9IkIrY1D6liORo-FmG65gw5qj-5RKHzD_QIs/edit?usp=sharing

PCR or polymerase chain reaction, is one of the most useful tools in a biologists tool kit. It allows you to take a DNA sample, select a part of it and make millions of copies of that section, amplifying it millions of times over. These newly grown fragments can be used as a diagnostic tool, or to generate pieces that can be used in other processes. Today we take a deep dive into the world of PCR and explore how it works, how you design the reactions, and how they're run in the lab. In a future video we may also look at how to build the thermocycler that makes this process possible, but there are lots of great tutorials on building them already online. We also take a step forward in the spider silk project and successfully isolate 1 of the 2 genes we'll need for the project. We're still trouble shooting the other so that will be the topic of a future video. The fragment we isolated is directly usable in our construction pathway and will be inserted to build a new new plasmid we're calling pKlac2g418. This means we're only a few more steps away from finishing our plasmid and making our first spider silks! Resources: Spider beer overview - https://www.youtube.com/watch?v=Fx8TcGrCOSI Gel electrophoresis - https://www.khanacademy.org/test-prep/mcat/chemical-processes/separations-purifications/v/gel-electrophoresis Crash course chemistry - https://www.youtube.com/watch?v=FSyAehMdpyI&list=PL8dPuuaLjXtPHzzYuWy6fYEaX9mQQ8oGr Crash course biology - https://www.youtube.com/watch?v=QnQe0xW_JY4&list=PL3EED4C1D684D3ADF The manga guide to molecular biology - https://www.amazon.ca/Manga-Guide-Molecular-Biology/dp/1593272022 Genome compiler - https://designer.genomecompiler.com/app Primer3 - http://primer3.ut.ee Snap gene - http://www.snapgene.com/ _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Vanderpot Alexander Halbleib Alexandre Guhur Anatoly Bazarov Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Christian Bastos Colby Callahan Danny Chan Daneil Gunn David Golouski Elliot Turner Frank Felix Nica Harlad Ian Tosta Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Philipp Weber Pietro Saccardi Rauni Simon Hallam Skave Rat Tom Bullock TheQuickestBrownFox Vasilis

It's been a roller coaster of a week so today I'm going to tell you the story of how I was sent water, instead of DNA. After 2 tests (technically 3 if you count the failed yeast video) confirmed it, I now know why the glowing yeast we tried to make in an earlier video didn't work. Speaking of glowing yeast, we've been brewing a batch of glowing pumpkin mead with the preengineered yeast that came in the kit and it was finally ready, right in time for our halloween party. Finally a little unboxing of the last of the bio supplies for the spiderbeer project and some of the fun surprises contained inside, like a fresh batch of P. microspora, the plastic eating fungus! Missed videos: Grab bag 6 - https://youtu.be/8mnj5evjMX4 Building an incubator/heatblock - https://youtu.be/Zm378x6zJYc Where the GFP yeast came from: http://the-odin.com _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Vanderpot Alexander Halbleib Alexandre Guhur Anatoly Bazarov Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Colby Callahan Danny Chan Daneil Gunn David Golouski Elliot Turner Frank Harlad Ian Tosta Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Pietro Saccardi Rauni Simon Hallam Skave Rat Tom Bullock TheQuickestBrownFox Vasilis

It's been a busy week in the lab so this week we'll be covering the progress on the various projects that are underway. First a bit of streaking to test out the incubator we built last week and to prepare for upcoming experiments. Then onto a hardware mod project I've been working on focused on converting a cheap microscope to do fluorescence microscopy. After that we cover the progress on the spider beer project and run our first PCR reaction and gel to see how it did. And for the 8 million of you that asked, we're officially restarting the styrofoam worm project. Stick around till the end for a few viewer questions! _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Vanderpot Alexander Halbleib Alexandre Guhur Anatoly Bazarov Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Colby Callahan Danny Chan Daneil Gunn David Golouski Elliot Turner Frank Harlad Ian Tosta Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Pietro Saccardi Rauni Simon Hallam Skave Rat Tom Bullock TheQuickestBrownFox Vasilis

Two of the most useful tools in biology are also some of the simplest and are just things that need to warm up to a particular temperature and stay there. Today we're building two such devices, an incubator, and a heat block. Incubators keep their contents at a nice even temperature to speed up the growth of organisms. Heat blocks are dense, dry, heat sources for heating reactions to specific temperatures, often far higher than an incubator will ever go. Heat blocks are used during ligations, transformations, restriction digests and more. Best of all heat blocks are temperature regulated so there's no need to babysit them the way you do with a water bath. Probably the best part of this design is that it uses such readily available materials that it can be adapted for whatever vaguely warm container applications you'll have, like building bioreactors, which we'll explore in future videos. Materials: Peltier - https://www.amazon.ca/ZTDM-TEC1-12706-Thermoelectric-Peltier-Cooler/dp/B002UQQ3Q2/ref=sr_1_8? Temp controller 1 - https://www.amazon.ca/gp/product/B01E9IO6N0/ref=oh_aui_detailpage_o05_s00? Temp controller 2 - https://www.amazon.ca/gp/product/B01I6LQKRQ/ref=oh_aui_detailpage_o00_s00? Heating pad - https://www.amazon.ca/gp/product/B018VQ72RI/ref=oh_aui_detailpage_o05_s00? _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Afrotechmods Alex Vanderpot Alexander Halbleib Alexandre Guhur Anatoly Bazarov Andrew Gray Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Danny Chan Daneil Gunn David Golouski Elliot Turner Frank Harlad Ian Tosta Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Kevin Comerford kn0tsin Kush Agarwal Larry Leon Schutte Matt KI7ZTH Michael Chatzidakis narvutar1324 Nico Schlüter Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Pietro Saccardi Rauni Simon Hallam Skave Rat Tom Bullock Vasilis

This week we kick off the start of the spider beer project which is the big genetic engineering project I've been talking about. For this weeks video I'll be going over the whole project and what it's going to take to make it work. The project is relatively straight forward. We'll be taking a silk gene out of black widow spiders, and building a plasmid that makes it express in a species of yeast so that it can be produced en mass easily. This isn't the end of the project though. Once we make it through the above, there are more changes and tweaks we'll be making, but this is the first goal post and will be a major success if it works. Once this plasmid is built it will be released for those interested to play around with and modify for their own projects. In theory the whole procedure will be done in about 2 days once the last of the materials arrive, but since this is biology I'm assuming it'll take far longer to actually succeed. And when all's said and done, I'm planning to write a paper on all of this with my collaborator and publish it in a peer reviewed journal. Once I'm comfortable working with these silk sequences we'll explore silks from other species like spider mites, and may eventually move past yeast and start modifying silk worms to produce these silks instead of their native variants. We'll also explore extracting and spinning fibers from the silk we produce in yeast. Some links: PCR - https://en.wikipedia.org/wiki/Polymerase_chain_reaction Gibson assembly - https://en.wikipedia.org/wiki/Gibson_assembly Overview of recombinant spider silks - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3815454/ Pklac2 plasmid backbone - https://www.neb.com/products/n3742-pklac2-vector#Product%20Information _________________________________________________________________ Support the show and future projects: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Alexander Halbleib Alexandre Guhur Anatoly Bazarov Anita Fowler Austin Morris Ben Krasnow Ben Reay Bennet Huch besenyeim Cataract Bumblesnatch Danny Chan Harlad Jase Smith Jim Mussared Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Larry Leon Schutte Michael Chatzidakis narvutar1324 Nicolas Pourtalé Noah Pedersen OmuN Oliver Patrick Sweetman Patryk Wycech Paul Emmerich Paul Richmond Rauni Simon Hallam Skave Rat Tom Bullock Vasilis

Genetic engineering is this summers hot topic and for good reason - IT'S AWESOME. To get the basic concepts down we'll be working through a kit from a company called "The Odin" which supplies kits and materials for learning the basics of genetic engineering. This first kit takes you through the process of inserting new DNA into yeast that makes them produce a protein that glows green under black light. The yeast are perfectly safe to eat so they can be used to make glowing beverages. Wanna give the kit a try or get some of the glowing yeast for yourself? Then head over to: http://www.the-odin.com Links: Streaking- https://www.youtube.com/watch?v=RMtdpP1ONx0 Making media - https://www.youtube.com/watch?v=L0o51eco6Vg Sigma Procedure- https://www.sigmaaldrich.com/technical-documents/protocols/biology/yeast-transformation-protocols.html Berkeley Procedure- http://mcb.berkeley.edu/labs/koshland/Protocols/YEAST/LiAc.html _________________________________________________________________ Support the show: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jennifer Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg Morten Ericson narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Emmerich Paul Richmond Rauni Simon Hallam Skave Rat Tom Bullock Vasilis

In the world of biohacking and citizen science, there's a growing propensity for spending all your time making tools, especially through the use of garbage starting material. This is often framed as "opening access" but in reality it's still just garbage. The other issue is that if you spend all your time making these garbage tools, you never end up getting things done, and the repeatability of whatever you've done is much lower. So in this video I discuss my thoughts on this, the times I've made this mistake and call on those in the community to instead shift the focus to a conversation about which things are worth buying, which are worth buying used and fixing, and which are actually worth building. Trash flavored trash article: http://theantisense.com/2018/09/26/biohacking-trash-flavored-trash/ _________________________________________________________________ Support the show: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jennifer Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg Morten Ericson narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Emmerich Paul Richmond Rauni Simon Hallam Skave Rat Tom Bullock Vasilis

One of my all time favorite papers is unsurprisingly co-authored by one of my favorite researchers. Titled, Better Together, it details the various ways we can make microbe not only coexist, but share their abilities to do even more complex tasks. From improved bioremediation of contaminated water, to producing fuel or medicines using only sunlight, microbial consortia are some of the most fascinating systems in biology. These systems are not only more capable, but also more robust and efficient. In this video we explore some of these systems and a few ways they can be engineered. We cover spatial patterning as well as some synthetic biological tricks to make organisms co-exist. This was inspired by a TED talk given by Neri Oxman, head of the Mediated Matter research group and the MIT media lab and some of the incredible work by her and her students. Ted talk: https://www.ted.com/talks/neri_oxman_design_at_the_intersection_of_technology_and_biology?language=en Paper: http://web.media.mit.edu/~neri/MATTER.MEDIA/Publications/Better_together-_engineering_and_application_of_microbial_symbioses.pdf Mediated matter research group: http://matter.media.mit.edu/ Interested in some of the research being done by Scihouse? Then head over to the Scihouse youtube channel, or check out the website for updates on ongoing projects: Website- http://scihouse.space Youtube Channel- https://www.youtube.com/channel/UCNmhA0cv119S6lF3FxRZRwQ Twitter- https://twitter.com/scihousejax?lang=en _________________________________________________________________ Support the show: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jennifer Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg Morten Ericson narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Emmerich Paul Richmond Rauni Simon Hallam Skave Rat Tom Bullock Vasilis

In the fall of 2016 I saw my first rocket launch and little did I know that the satellite on that rocket would come to shape and fill my thoughts for many years. We're no strangers to getting data out of space on this channel, but GOES-16 is special, and not just because I was there when it left earth. Unlike the satellites we looked at in the past, GOES is in geostationary orbit and has an amazing suite of cameras and sensors on board. While it's a bit harder to receive data from GOES the extra effort is absolutely worth it, especially because it can see then entire globe all at once and send out those images in stunning high resolution. And it even comes with the added bonus of rebroadcast data from other satellites giving us a view of the opposite side of the planet as well. In this video we go through the hardware and software needed to receive these gorgeous images and what is contained in the signals we receive. A huge thank you to Lucas and the Open Satellite project crew, Pieter N, and Paul for making this project possible. Lucas's Pages: https://www.teske.net.br/lucas/satcom-projects/satellite-projects/ https://twitter.com/lucasteske https://www.youtube.com/channel/UCVTufsGGlhG6tLfERgG_HlQ https://github.com/OpenSatelliteProject Pieter's Pages and GOEStools software: https://pietern.github.io/goestools/guides/minimal_receiver.html https://twitter.com/pnoordhuis?lang=en Artem's channel: https://www.youtube.com/channel/UCGeuWDMjXdnD3wVflwuEnqA Foulab: https://foulab.org Satellite app: https://play.google.com/store/apps/details?id=com.agi.android.augmentedreality&hl=en_CA Also a special thank you to Nooelec for sending me the new NESDR XTR and a second sawbird filter!! _________________________________________________________________ Material list: Antenna - https://www.amazon.com/Altelix-Directional-Parabolic-Connector-Resistant/dp/B06ZYSRDJT/ref=sr_1_3?ie=UTF8&qid=1536262888&sr=8-3&keywords=wifi+grid+antenna Amplifiers - https://www.amazon.com/50-4000MHz-Amplifier-SPF5189-Signal-Receiver/dp/B076ZQTY8S/ref=sr_1_3?ie=UTF8&qid=1536262930&sr=8-3&keywords=lna Sawbird filter - http://www.nooelec.com/store/sdr/sdr-addons/sawbird/sawbird-plus-goes.html RTLSDR - https://www.amazon.com/NooElec-NESDR-Mini-Receiver-RTL2832U/dp/B00VZ1AWQA/ref=sr_1_3?ie=UTF8&qid=1536262977&sr=8-3&keywords=rtl+sdr+nooelec+mini NESDR XTR - https://www.amazon.com/NooElec-NESDR-SMArt-XTR-Bundle/dp/B06Y1FDDBF/ref=sr_1_3?ie=UTF8&qid=1536262994&sr=8-3&keywords=nooelec+xtr _________________________________________________________________ Support the show: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jennifer Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg Morten Ericson narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Emmerich Paul Richmond Rauni Simon Hallam Skave Rat Tom Bullock Vasilis

Every good scientist needs a lab, so this week we're going over how I built my new one! This lab is designed for biology work, specifically genetic engineering of bacteria and yeast. That said it can easily be modified to work with plants as well. As a positive pressure room it could almost be used for working on hard drives and other sensitives components if you added an air lock. This video is the first part of a series where I'll take you through building and stocking a genetic engineering lab. Support open source science: Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jennifer Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg Morten Ericson narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Emmerich Paul Richmond Rauni Simon Hallam Skave Rat Tom Bullock Vasilis

Enjoy the videos and music you love, upload original content, and share it all with friends, family, and the world on YouTube.

It's been a busy week as we work to build the new bio lab. So this week we're taking a short break to complete some projects we've got in the works and build the new lab. But it certainly hasn't been a fruitless week. We managed to receive our first signals from GOES 16 and are only a short while off from turning those signals into beautiful images. Also the new laser hardware has started to arrive as has the bio labs supplies. Another fun package that arrived was a pair of awesome broadband palm tree vivaldi antennas which I'm very excited to put to use. We'll either be using them to increase the range of pipsqueak or we'll turn them into a radar system. If you'd like a pair for yourself, head over to: https://www.tindie.com/products/hagster/ultra-wideband-vivaldi-antenna-800mhz-to-6ghz/ This isn't a paid promotion, I just like supporting people who do good work. Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Arnis Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Richmond Rauni Simon Hallam Vasilis

Last week we started building a motorized mount for a 1m parabolic grid antenna. The goal of the project is to create a versatile system that can be used for a wide array of projects down the line, from pulling data off of satellites, to radio astronomy and so much more. This week we finish making the remaining pieces, wire everything up and get the system moving. Resources: SVGs/measurements: (Will be added later) Code to control things: https://github.com/FOULAB/Project-COGSWORTH Antenna: https://ebay.to/2AzaIZR _________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Arnis Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Richmond Rauni Simon Hallam Vasilis

We've built a couple radio telescope on this channel over the years. The first took a picture of the sky in microwave frequencies and the second took a picture of wifi signals in a building. This time we're scaling up both the size of the telescope and the quality and utility of the build. Part of being a radio telescope is that it also happens to fulfill the role of satellite tracker which will allow us to receive data from more satellites that ever before. We looked previously at getting images from NOAA satellite, but they also put out a higher resolution image at a higher frequency near where the antenna is tuned to. Further, this exact antenna has been used for GOES 16 reception so we'll give that a try when my new filter arrives. Everything was either off the shelf or cut with a small CNC mill, but could be made by hand with sufficient patience. The SVG files for building on of these for yourself will be uploaded next week, Antenna: https://ebay.to/2AzaIZR _________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: Al Dass Alexander Halbleib Alexandre Castlenine Alexandre Guhur Anatoly Bazarov Anita Fowler Arnis Austin Morris Ben Davis Ben Krasnow Ben Reay Bennet Huch besenyeim BioQuisitive Cataract Bumblesnatch Evan wood Jase Smith Jim Mussared John De Witt Jonas Abreu Jonathan Anderson Justin Hendryx Kevin Comerford kn0tsin Kolvenik Larry Leon Schutte Michael Chatzidakis Michael Gregg narvutar1324 Nicolas Pourtalé Noah Pedersen Oliver orotusso Patryk Wycech Paul Richmond Rauni Simon Hallam Vasilis

In my pursuit of nonlinear optics it became obvious that if I was serious about learning about high power lasers and the cool things you can do with them, I was going to need better mounts to hold my components. In this video we go through the first one of these which is a holder for my nonlinear crystals. This was prompted by a visit to one of the femtosecond laser labs at U of T last week. Not only did I get to see their amazing setup, I also got to see what nonlinear effects look like for real. Thank you so much to Olivier for the invite! _________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim -Narvurtar1324 -Alexandre Castlenine -Kevin Comerford -Kolvenik -Ben reay -Arnis -Alexander Halbleib

Enjoy the videos and music you love, upload original content, and share it all with friends, family, and the world on YouTube.

Quantum entanglement is one of the weirdest physical phenomena. If you take 2 linked particles and mess with 1 of them, no matter how far away it's partner is, it will also be instantly affected. But making entangled particles isn't magic, nor does it require a super expensive and complicated machine. All that's required is a laser, a non linear crystal and a bit of ingenuity. And all of that can be made out of garbage. In this video we built a simple DIY laser called a TEA laser, and shoot it through a crystal made of a common fertilizer to produce some entangled photons. The trick though is detected those photons and our first attempt was a failure. But with the groundwork laid, we can iterate and improve until we confirm the measurement. So it's not that the photons weren't produced, they almost certainly were. Just so few were captured by my camera they were obscured by noise. Resources: DPSS/Second Harmonic: https://www.youtube.com/watch?v=sF2RDJISnAs Double Slit/Interferometer: https://www.youtube.com/watch?v=VvdnZn2GDVw Plancks constant: https://www.youtube.com/watch?v=q0jLUpBqess Styropryos video: https://www.youtube.com/watch?v=1psxE4NlECQ RImstars video: https://www.youtube.com/watch?v=v9sKqGC3t-0 Parts: Transformer: https://amzn.to/2uiSztG Rotary cutter: https://amzn.to/2ufOo1W Lamination sheets: https://amzn.to/2zED0Su ____________________________________________________________________ _________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim -Narvurtar1324 -Alexandre Castlenine -Kevin Comerford -Kolvenik -Ben reay -Arnis Alexander Halbleib

Microstrip or distributed element filters and an elegant solution to a complex problem. How do you filter out parts of the radio spectrum you don't want, without having to manufacture accurate capacitors and inductors at small scales. They also have the advantage of being relatively easy to manufacture by simply milling the right pattern on regular PCB material. While they aren't perfect, they work well for frequencies between 400-1800 mhz. In this video we cover the basics of CNC milling and how some of these filters are made. Resources: Svg files - Will be uploaded shortly Paper this was based on: http://www.w1ghz.org/filter/Recipes_for_Printed_Hairpin_Filters.pdf GOES software: https://github.com/OpenSatelliteProject/SatHelperApp Other Goes software: https://pietern.github.io/goestools/guides/minimal_receiver.html Inkscape: https://inkscape.org/en/release/0.92.3/ Jscut: http://jscut.org/jscut.html _________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim -Narvurtar1324 -Alexandre Castlenine -Kevin Comerford -Kolvenik -Ben reay -Arnis

I've been chasing more and more complicated radio projects for over a year now and I thought it was finally time to invest in a more serious antenna. But I wanted one that anyone could build, not just one I bought. So I set out to build one as large as possible on the smallest budget. Based on a 3d corner reflector design I originally found on http://neutronstar.joataman.net/ the design should be more than capable of picking up everything from satellite transmissions from the geostationary band, moon bounces, and will be very useful for radio astronomy. One detail I wanted to clarify was the monopole that acts as the second electrode in the antenna. I talked about it briefly in the video but it isn't actually shown. Nor have I added the coax for connecting to our radio receiver yet. Both pieces will be added in the next video where we take this for a test drive. _________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop _________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim -Narvurtar1324 -Alexandre Castlenine -Kevin Comerford

What would it be like if our eyes could see more colors? We may never be able to answer that, but we can build devices that can do the work for us. Over the last three weeks we've been building a DIY radio telescope tuned to 2.44 Ghz which is right in the middle of the wifi band. With it we hoped to take a picture of a building and see all the wifi routers inside it. This is the third part of the series and I'm pleased to announce the project was a complete success! If you haven't seen the first and second videos, I'd highly recommend watching those first. Part 1: https://www.youtube.com/watch?v=o6WHhqDHSQ4 Part 2: https://www.youtube.com/watch?v=VABeN4uv03s This week we mapped the inside of the hackerspace (Foulab) I've been working in and then stepped up to taking an image of the whole building. Not only were we able to see our router, we could see at least half a dozen others, and even one across a courtyard at least 100m away. The images were very large since they were full 360 degree panoramas, so too get a better view of them head over to my facebook page at the following link to see them at full size! Image 1 Inside the building: https://bit.ly/2LXmA92 Image 2 Full building: https://bit.ly/2JZMvfI Want to try and build one of these yourself? Here's a link to all the code needed to run a robot like this and turn all the captured data into an image: https://github.com/FOULAB/Project-COGSWORTH __________________________________________________________________ A special HUGE thank you to Foulab and especially Paul for making this project possible. Foulab: https://foulab.org __________________________________________________________________ Some more resources Power meter GNU radio: https://www.tablix.org/~avian/blog/archives/2015/04/signal_power_in_gnu_radio/ DC offset fix (Didn't actually end up using this, but it's still useful): https://www.rtl-sdr.com/removing-that-center-frequency-dc-spike-in-gnuradio-the-easy-way/ GNUradio: https://gnuradio.org __________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim -Narvurtar1324

Last week we started on the construction of a mini radio telescope with 2 main goals. The first is to design a scalable system so that later projects can be built with larger and larger antennas for imaging the sky and pulling data from far away satellites. The second is to use this prototype to take images of terrestrial frequencies, starting with WIFI. If you missed last weeks video heres a link so you can get caught up: https://youtu.be/o6WHhqDHSQ4 This will be a 3 part series as this project has been one of the more complex and is taking time to sort out all the bugs and kinks. This week we finished assembly and got everything moving and starting working on the radio capturing script. Next week we'll have some actual images and will go through the coding and programs used to run this robot. Power meter GNU radio: https://www.tablix.org/~avian/blog/archives/2015/04/signal_power_in_gnu_radio/ DC offset fix: https://www.rtl-sdr.com/removing-that-center-frequency-dc-spike-in-gnuradio-the-easy-way/ GNUradio: https://gnuradio.org __________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Chris Carrigan Brolly -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim

Radio telescopes are phenomenal tools for exploring how the world looks in frequencies far to low for any camera to see. In a previous video we built a telescope capable of seeing 12ghz radiation and used it to take a picture of geosynchronous satellite orbiting the earth. This inspired another idea. What if instead of Ku band (that 12ghz signal) we looked at wifi signal instead. Further, the same system could be used to track satellites as they orbit and pull high quality data from them. While at the time of upload the device isn't fully functional, it is built and we've managed to make it move. In the next video we'll finish the control system and begin taking images and looking for satellites. Artem's channel: https://www.youtube.com/user/val3tra Antenna Calculator: https://www.changpuak.ch/electronics/calc_12a.php Gear generator: http://geargenerator.com/#300,300,100,6,0,1,0,2,1,31,5.166666666666667,6,20,-60,0,0,10,1.6666666666666667,6,20,-90,0,0,2,1718 Foulab: https://foulab.org __________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Chris Carrigan Brolly -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim

As I've been getting settled in the new city and starting to explore I've been meeting a ton of amazing people and visited many of the local maker spaces. I've been going through old footage and stumbles onto old projects that may be worth exploring again. Let me know what you think and which ones you'd like to see me do the most! Foulab: https://foulab.org Brico.Bio: http://brico.bio/ Number station schedual: http://priyom.org/number-stations/station-schedule WebSDR: http://websdr.ewi.utwente.nl:8901/ __________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -Bill Russell -John De Witt -Terry Fuller -Anatoly Bazarov -Rauni -Chris Carrigan Brolly -Ben Davis -Alexandre Guhur -Ben Krasnow -Michael Gregg -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim

As biological organisms, plants contain immense complexity in their structure and organization. But from our distance vantage point we can only see the macroscopic results of that complexity. Today we look at a simple technique that allows you to see the structure of plants on the inside and gain tremendous insight into their function. Orcein - https://www.youtube.com/watch?v=4pRYHrPJ8Eo Polarized Light - https://www.youtube.com/watch?v=Knb8LzGmh6E Focus Stacking - https://www.youtube.com/watch?v=3wfI_rEGyDw __________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -John De Witt -Terry Fuller -Rauni -Chris Carrigan Brolly -Ben Davis -Alexandre Guhur -Ben Krasnow -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -OmuN -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim

Since their invention, telescopes have been used by astronomers to study the stars. As technology and theory advanced a need for larger and larger telescopes grew. Where the first telescopes were light enough to pick up and move, modern scopes take up entire specialized buildings and our largest is planned to be 40 meters wide. But we're starting to hit the limit of how large we can make our telescopes as the cost to make these behemoths increases exponentially with size. A 1 meter telescope costs up to 250,000 whereas the monster 40m one will cost almost a billion. In this video we explore a design for what would be the largest telescope humanity will ever use. It would allow us to take images of an exoplanet from over 100 light years away at better resolution than hubble is able to see mars from earth. The proposed FOCAL spacecraft uses a weird property of space called gravitational lensing to bend light around the sun as if it was a giant lens. Codyslab aragoscope: https://www.youtube.com/watch?v=5RacK2VwqEk&t=321s Satellite images: https://youtu.be/cjClTnZ4Xh4 Radio telescope: https://youtu.be/aeah3fFYlnA Why jupiter is a bad option: https://www.physicsforums.com/threads/jupiter-as-a-gravitational-lens.101614/ Source: https://arxiv.org/abs/1604.06351 __________________________________________________________________ Patreon: https://www.patreon.com/thethoughtemporium Store: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -John De Witt -Terry Fuller -Rauni -Chris Carrigan Brolly -Ben Davis -Alexandre Guhur -Ben Krasnow -Daniel Henneberger -Paul Richmond -Jim Mussared -Pedro Blanc Arabe -Ryan Whited -kn0tsin -OmuN -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler -Besenyeim

You were probably taught that there are 3 things in your blood: Red blood cells, platelets, and white blood cells. The reality, as is often the case, is more complicated than that. White blood cells actually refer to a whole family of cells that all make up the different parts of your immune system. One of the main soldiers in your immune systems army are T cells which recognize foreign bodies and destroy them. In some of the newest cancer therapies scientists are using genetic engineering to teach a patients own T cells how to find cancer cells so that they can be destroyed. This way only cancer cells are damaged and the rest of the body remains healthy, unlike in traditional chemotherapy and radiation. Over the past several months I've been in Florida visiting my friend Gabriel Licina and his mammalian cell culture lab. While there I got to film the process of extracting T cells from whole blood which uses some incredible biochemistry to make possible. Lactose gene therapy: https://www.youtube.com/watch?v=J3FcbFqSoQY Cryogel: https://www.youtube.com/watch?v=R3QOBxpe3Gw Silica DNA extraction beads: https://www.youtube.com/watch?v=Ny0xcCD14Z4 __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Anatoly Bazarov -John De Witt -Terry Fuller -Chris Carrigan Brolly -Ben Davis -Guhur Alexandre -Ben Krasnow -kn0tsin -OmuN -Morten Eriksen -BioQuisitive -Patryk Wycech -Al Dass -Larry -Michael Chatzidakis -Oliver -Justin Hendryx -orotusso -Alex Lemna -Cataract Bumblesnatch -Anita Fowler

Everywhere you look nowadays you find AI. From filters on snap chat, tools in photoshop, the ads next to videos and even the video suggestions next to this video. Two such AI programs allow you to make amazing AI art and bend reality in weird ways. Style transfer allows you to take the style from one image, like Van Gogh's Starry Night, and transfer it to a different image. This allows you to quickly generate new master pieces by your favorite artists, or give something a fresh look. There is a version of this program that works on videos too which we'll explore in the future. Deep dream on the other hand is ai turned on it's head. Instead of using the AI to classify things, we allow it to manipulate an image to fit some of the data its already learned. This produces sureal images where animals and structure get generated out of noise. All of this is done in an online tool called Deep Dream Generator: https://deepdreamgenerator.com Some further reading and references: Original Paper Style Transfer - https://arxiv.org/pdf/1508.06576.pdf Deep Dream Article - https://research.googleblog.com/2015/06/inceptionism-going-deeper-into-neural.html Deep Dream Video by computerphile - https://www.youtube.com/watch?v=BsSmBPmPeYQ __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Al Dass -Patryk Wycech -Larry -Adam Sheppard -Michael Chatzidakis -Oliver -Justin Hendryx -Paul Emmerich -orotusso -Alex Lemna -Cataract Bumblesnatch -Jonas Abreu -Anita Fowler -Ben Davis -Guhur Alexandre -Ben Krasnow -Anatoly Bazarov -John De Witt -Terry Fuller -BioQuisitive -Morten Eriksen -Omun

Normally the ability to do polarized light microscopy at least doubles the price tag of any new microscope you purchase. And that's kind've of a shame because with only the addition of 2 simple polarizers a whole new world of detail is opened up. This mod requires only the purchase of 2 cheap pieces of polarizing film and everything takes only a few minutes to set up. Once done, the effect can be turned on and off at will. See the stresses inside fibers or defects in glass as crazy color changes or spot minerals that were otherwise invisible. Dark field microscopy is also interesting as it uses a simple optical hack to give the impression of a dark background for subjects. The conversion process is just as easy as polarized light and can also be set up in a couple minutes. Focus stacking- https://www.youtube.com/watch?v=3wfI_rEGyDw The lichen responsible for modern biology - https://www.youtube.com/watch?v=4pRYHrPJ8Eo __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Al Dass -Patryk Wycech -Larry -Adam Sheppard -Michael Chatzidakis -Oliver -Justin Hendryx -Paul Emmerich -orotusso -Alex Lemna -Cataract Bumblesnatch -Jonas Abreu -Anita Fowler -Ben Davis -Guhur Alexandre -Ben Krasnow -Anatoly Bazarov -John De Witt -Terry Fuller -BioQuisitive -Morten Eriksen -Omun

Lichen are weird organisms to begin with, but what you probably didn't know is that they are the source of dyes that helped kickstart modern biology and chemistry. One such dye, made from a lichen called Roccella tinctoria is especially useful as it can stain DNA, elastic fibers, copper proteins and more. Early biologists used it in a series of experiments that helped pave the way to where we are today. The dye was responsible for the discovery of the nucleus, chromosomes and even helped confirm inheritance patterns described by Mendel. In this video we use the dye to preform 2 experiments. We visualize the steps of mitosis in onion roots tip squashes, and polytene chromosomes in fruit fly larva. Scibus adventures: https://www.youtube.com/channel/UC8TsKsWmKqV5uqxGcRzC6Fg __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Al Dass -Patryk Wycech -Larry -Adam Sheppard -Michael Chatzidakis -Oliver -Justin Hendryx -Paul Emmerich -orotusso -Alex Lemna -Cataract Bumblesnatch -Jonas Abreu -Anita Fowler -Ben Davis -Guhur Alexandre -Ben Krasnow -Anatoly Bazarov -John De Witt -Terry Fuller -BioQuisitive

Even non star wars fans know about the Death Star. It's maybe the most iconic doomsday weapon, known for blowing up entire planets. But you could never build a laser that big.... right? Well maybe. Chemical lasers are the closest real world equivalent and they can pack an immense punch. In this video we explore one such laser called and AGIL or All Gas Iodine Laser which is currently in use by the military. For those interested in some more specifics about the maths, sixty symbols did a great video breaking it down. 2 notes I'll make quickly that'll make sense once you watch their video. 1) Mount Everest isn't actually that big/massive. A couple good sized asteroids would provide the material for feed stock. 2) Why hypermatter, while BS makes sense. I assume it would be some sort of weird unstable condensed form of matter, of which there are many real world examples. Think metalic hydrogen, or neutronium. Both very real, very sci fi sounding types of matter that contain more than enough energy to blow up a planet. Anyway, see their video for more: https://www.youtube.com/watch?v=HDL0KAm9Cbs&feature=youtu.be Paper: http://sci-hub.la/10.1109/JQE.2003.814381 Patent: https://patents.google.com/patent/US6459717 __________________________________________________________________ DPSS lasers - https://www.youtube.com/watch?v=sF2RDJISnAs Double Slit and Interferometer Build - https://www.youtube.com/watch?v=VvdnZn2GDVw Measuring Planck's Constant - https://www.youtube.com/watch?v=q0jLUpBqess __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Al Dass -Patryk Wycech -Larry -Adam Sheppard -Michael Chatzidakis -Oliver -Justin Hendryx -Paul Emmerich -orotusso -Alex Lemna -Cataract Bumblesnatch -Jonas Abreu -Anita Fowler -Ben Davis -Guhur Alexandre -Ben Krasnow -Anatoly Bazarov -John De Witt -Terry Fuller

Focus stacking is a great trick to tease more detail out of the thing you're photographing. By combining many images of the same subject, taken at different focal lengths, you can create extremely deep photos that tend to look very realistic. This is because our eye does this so fast that we don't notice it. So we're used to very deep field images. This technique works especially well with images under a microscope, or with macrophotography, but can also work well with landscape shots. Gallery: https://www.facebook.com/pg/thethoughtemporium/photos/?tab=album&album_id=2113674368868948 Bens video: https://www.youtube.com/watch?v=HVSjUW2qQ6U _________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Special thanks to: -Al Dass -Patryk Wycech -Larry -Adam Sheppard -Michael Chatzidakis -Oliver -Justin Hendryx -Paul Emmerich -orotusso -Alex Lemna -Cataract Bumblesnatch -Jonas Abreu -Anita Fowler -Ben Davis -Guhur Alexandre -Ben Krasnow -Anatoly Bazarov -John De Witt -Terry Fuller

The grab bag series is a chance to share some shorter clips, updates and sneak peaks. This time I cover my time at bodyhacking con, how to make Moroccan brine lemons, some astronomy time-lapse, a glowing fungal species, the butter fly show at my old university and some patron questions. If you've got a topic or questions you want to see in the next video in this series, consider becoming a patron by heading over to: https://patreon.com/thethoughtemporium Did you like one of the designs you saw and want one for yourself? Grab one now and support the show by clicked here: https://www.redbubble.com/people/chironex/shop?asc=u __________________________________________________________________ Rich's Talk: https://www.facebook.com/TranshumanDocumentary/videos/2051846108427590/?hc_ref=ART_dhN9Lwzb3sTrcntxn338Vt3l8A1uER1ZqMLnxySYwOgFCv6oTLc_pqa41W7z9I8 Bodyhacking con: https://bodyhackingcon.com/ Butterfly show links: https://carleton.ca/biology/annual-butterfly-show/ __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Michael Chatzidakis -Oliver -Justin Hendryx -Paul Emmerich -orotusso -Alex Lemna -Cataract Bumblesnatch -Jonas Abreu -Anita Fowler -Ben Davis -Guhur Alexandre -Ben Krasnow -Anatoly Bazarov -John De Witt -Terry Fuller

With powerful enough lasers, the world starts behaving very differently. Using a nonlinear optical process called second harmonic generation you can merge pairs of photons in a laser beam to create a single photon with twice the energy. This means that one color of light is turned into another. In practice this is done with infrared lasers which when shot through a special crystal merge to form a color like blue or green depending on the setup. The laser I'm using I got online for less than $100, but it contains a 2.5w IR (808nm) laser, and a 50-100mw blue (473nm) laser. The machine itself is also a decommissioned Raman spectroscope, which I'll be trying to repair. __________________________________________________________________ Subscribe to styropyro: https://www.youtube.com/channel/UCJYJgj7rzsn0vdR7fkgjuIA __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -John De Witt -Paul Emmerich -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu -Alex Lemna -Orotusso -Cataract bumblesnatch -Ben krasnow -Justin Hendryx -Oliver -Alexandre Guhur -Ben davis

Wakefield accelerators are new to the world of particle colliders, but they are quickly becoming very popular. They allow you to accelerate particles to very high energies in a fraction of the space a normal accelerator would require. Today we take a deep dive into particle physics to learn about accelerators, wake fields, magnetohydrodynamics, cosmic rays and more. Resources: https://accelconf.web.cern.ch/accelconf/p05/PAPERS/TPAE057.PDF https://www.sciencedirect.com/science/article/pii/S016890021301499X http://iopscience.iop.org/article/10.1088/0741-3335/58/3/034017/pdf https://www.youtube.com/watch?v=S94m95wm-hE http://physicstoday.scitation.org/do/10.1063/PT.5.7125/full/ https://www.nature.com/articles/nature13882 https://en.wikipedia.org/wiki/Air_shower_(physics)#/media/File:Protonshower.jpg http://www.slac.stanford.edu/cgi-wrap/getdoc/slac-wp-026-ch30a-Reil.pdf https://arxiv.org/abs/1306.0970 https://journals.aps.org/prab/abstract/10.1103/PhysRevSTAB.18.024401 __________________________________________________________________ Subscribe to Artem: https://www.youtube.com/results?search_query=theartlav __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -John De Witt -Paul Emmerich -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu -Alex Lemna -Orotusso -Cataract bumblesnatch -Ben krasnow -Justin Hendryx

Storage and transport is a vital part of any lab that does cell culture, but for anything other than bacteria and fungi, the ways to do this require extreme cold. Here we demonstrate how to prepare a ultralight foam from cross linked gelatin, which can be used to keep cells alive for up to a week at room temperature. No incubator, CO2, dry ice or liquid nitrogen required. The material is easy to make and prepare and the method works for both adherent and suspension cells. This was filmed while my friend was letting me do the lactose project in his lab. Since filming, he's used this method to ship cells and they survived and were able to be cultured. Link to original paper: https://www.nature.com/articles/srep41551 __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -John De Witt -Paul Emmerich -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu -Alex Lemna -Orotusso -cataract bumblesnatch

For more than half a decade I've suffered from lactose intolerance. If I consumed even the smallest amounts of lactose I'd be violently ill within the hour. So as I was choosing my university I vowed that one day I'd fix it. Recently my friend Gabriel Licina, renowned biohacker and genetic engineer, gave me access to the tools and materials I needed to make a therapy that could potentially fix the issue. The therapy uses a virus called an AAV to deliver DNA that codes for the enzyme that breaks down lactose. When packaged into a pill and ingested, the virus should induce my intestine to produce lactase, effectively restoring lactose tolerance. This project was based on research done by other scientists and I've included links to all the papers below. I've also included links to all of the places I got the viral DNA kits from. The other reagents and media were all purchased from the thermofisher catalogue. I'm also working on a writeup of this procedure and will hopefully publish a paper on the results once I've collected more data. I know that so far my sample size is still only N=1 but my life has changed from this project and I wanted to share my progress. I'm not going to make any claims about the project other than my life seems to have improved. This is for educational purposes only. Do not attempt anything you see, unless you are an experienced biologist. __________________________________________________________________ Resources: Original paper: http://sci-hub.tw/10.1038/2625 pAAVLacz Plasmid: https://www.cellbiolabs.com/paav-lacz-control-plasmid AAV kit: https://www.cellbiolabs.com/aav-2-cmv-expression-system __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu -cataract bumblesnatch

Freeze dryers are best known for the fun food items they can be used to make like astronaut icecream, but they're actually really useful tools. From ideal sample preservation, to the preparation of useful cryogels, freeze dryers are used all throughout science. As machines go, they're actually really simple with only a few parts, so in this video I demonstrate how to make a freeze dryer in an afternoon. Parts list: 1 gallon vacuum chamber - https://www.ebay.com/itm/SVac-1-Gallon-Tall-Stainless-Steel-Vacuum-Chamber-and-BVV130-3CFM-Mini-Pump-Kit/302605256298?hash=item4674adc66a:g:xLAAAOSw7p5aXn~Z 2 quart vacuum chamber - https://www.ebay.com/itm/Best-Value-Vacs-2-Quart-Stainless-Steel-Vacuum-Chamber-and-3CFM-Vacuum-Pump-Kit/282769398318?hash=item41d65e9a2e:g:YtUAAOSwTEJaLyow 2 gallon stainless steel cooking pot - https://www.ebay.com/itm/Stainless-Steel-Stock-Pot-8-QT-Quart-2-Gallon-Soup-Chili-Pasta-Beer-Brew-NOTE/162279406326?hash=item25c89b3af6:g:g00AAMXQUmFSnmZh 1/4" flare union - hardware store 5/8" barb splicer - hardware store foam sheets (I used styrofoam) - hardware store Glue (spray adhesive is ideal but most will work) - hardware store Dry ice - grocery store Denatured Ethanol - hardware store Svg2 field piece vacuum gauge - https://www.ebay.com/itm/Fieldpiece-SVG3-Digital-Micron-Vacuum-Gauge-Replaces-SVG2-Easy-View/121751043579?epid=19003302604&hash=item1c58ed7dfb:g:sbUAAOxyf~hRyedr 2 stage rotary vane vacuum pump - cheap models likely won't work. Invest in a decent pump __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

Back in 2005 Amal Graafstra became the first non commercial user of implantable RFID chips in humans. Following the intense interest by the public, he started the company DangerousThings and brought RFID implants to the market. Over the years the design has continued to be improved and the latest model is one of the coolest yet. Unlike it's earlier cousins, the FlexNT is a flexible RFID implant. This means it has a much larger antenna making it readable from much further away. In this video we go over the implant procedure and some of the many uses for an implant like this. Partner map: https://dangerousthings.com/partners/ __________________________________________________________________ Interested in some sweet science themed designs for your wardrobe or wall? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

While 2017 may have been a rocky year for the world, for the channel it was great. So many great projects go completed and so many more got started and I thought today would be a great opportunity to go through it all! From lasers, to radio telescopes, to baterial leather and more, there was almost too much to compress into one short video. Thanks for an amazing year, and I look forward to what we'll do in 2018!! __________________________________________________________________ Interested in one of the new designs in the store? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

In the past year the channel has gained over 10,000 subscribers and recently passed the 30,000 subscriber milestone! So first off, thank you so much for the support. To celebrate I made this Q/a video and tried to answer as many questions as I could that I collected from all of my social media accounts. Hopefully in 2018 we'll see the channel grow to 100,000 and get a silver play button. So thanks again for all the support and have a happy new year! __________________________________________________________________ Interested in one of the new designs in the store? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

Almost every day a new clickbait article goes by making yet another absurd claim, be it ginger curing cancer, vitamin c curing HIV, or in this case, canola oil worsens memory. And all of this is based on some new paper that came out. This happens for one of two reasons. Either the journalist misread the paper, or the paper makes claims but doesn't have the evidence to back it up. In this new series, we'll be either working with a great paper that is complex and exciting and break it down so the concepts are understandable. OR we'll be working with a paper that is at the heart of sensationalized garbage and picking it apart to see exactly WHY it's garbage. Through this the hope is that we can learn a lot about the differences between good papers and bad ones, and also explore some amazing topics along the way. In this first episode we're examining a paper that's been spreading a lot lately that makes the claim that a canola oil rich diet worsens memory and can lead to alzheimer like symptoms. This would be terrifying if true, but the paper has more holes than swiss cheese and we'll be examining them one by one. Scihub (currently working links): sci-hub.la sci-hub.hk sci-hub.tv sci-hub.tw sci-hub.name sci-hub.mn Link to the paper: -https://www.nature.com/articles/s41598-017-17373-3 __________________________________________________________________ Interested in one of the new designs in the store? Click the link below to see all the great items currently being offered: https://www.redbubble.com/people/chironex?asc=u __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

Kilns are extremely useful tools for a hug assortment of projects. From pottery, to metal melting, to supercapacitors they are useful for anything that requires extremely high temperature. That said, they can also be prohibitively expensive, so getting started with these hobbies and research areas can seem like an insurmountable challenge. Luckily, building one of these simple devices is not only straight forward, it's also far cheaper than buying a new or used kiln. Parts list that require online ordering: PID and solid state relay - https://www.amazon.com/Inkbird-Temperature-Thermostat-Controllers-Fahrenheit/dp/B01KNXETWS/ref=sr_1_4?ie=UTF8&qid=1512951772&sr=8-4&keywords=pid High temp wire - https://www.amazon.com/2-5mm2-Flexible-Resistance-Cable-Meter/dp/B00O9YGP8Y/ref=sr_1_3?s=local-services&ie=UTF8&qid=1512951792&sr=8-3&keywords=high+temp+wire Thermocouple - https://www.amazon.com/Temperature-Thermocouple-Ceramic-connector-CR-02/dp/B01N0YA9ZR/ref=sr_1_1_sspa?s=hi&ie=UTF8&qid=1512951807&sr=1-1-spons&keywords=kiln+thermocouple&psc=1 Kiln Element: https://www.amazon.com/uxcell-Furnaces-Casting-Flexible-Heating/dp/B01IS89EH0/ref=sr_1_1?ie=UTF8&qid=1516824073&sr=8-1&keywords=kiln+element Everything else can be sourced at a local hardware store. __________________________________________________________________ Looking for cute or cool sciencey gifts for the holiday season? Then check out my store on redbubble! New items added often: https://www.redbubble.com/people/chironex/shop Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

It's been a little over 2 months, which means it's time for the next grab bag video! As I'm working on projects there's lots of little offshoots that are interesting, but don't always merit an entire video. The grab bag video is my chance to share those little gems. This time we cover super absorbent carbon materials, synthesizing copper oxide, astrophotography, a reverse crystal garden and more! Casein book - https://archive.org/stream/caseinitsprepara00scherich#page/74/mode/2up Copper oxide synth paper - http://sci-hub.bz/10.1007/s11051-010-0064-6 __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/

Saying that quantum mechanics is weird is massive understatement. As we explore smaller and smaller scales, the rules of nature become less intuitive. Originally scientists assumed that the smallest things were point like particles and built their models around this idea. But this all came crashing down thanks to the famous double slit experiment. Suddenly it was shown that light can behave like a wave. At first it was assumed that light is purely a wave but thanks to Louis de Broglie, we now know that almost all fundemental particles, and even collections of particles can exhibit wave like properties. In this video we explore how the double slit experiment can be preformed using only candle soot and a laser pointer. Since light has wave properties, we can exploit them using a device called an interferometer. These devices are the heart of some of the most advanced physics experiments on earth, including LIGO, the redefinition of the Kg and many others. Here we explore how a simple interferometer can be made at home. More resoures on the topics covered: Veritasium Double Slit Experiment - https://www.youtube.com/watch?v=Iuv6hY6zsd0 Copenhaggen Interpertation - https://www.youtube.com/watch?v=p-MNSLsjjdo Many Worlds Interpertation - https://www.youtube.com/watch?v=dzKWfw68M5U Pilot Wave Theory 1 - https://www.youtube.com/watch?v=RlXdsyctD50 Pilot Wave Theory 2 - https://www.youtube.com/watch?v=WIyTZDHuarQ&t=218s Measuring Plancks Constant - https://www.youtube.com/watch?v=q0jLUpBqess FTIR Spectrophotometer - https://en.wikipedia.org/wiki/Fourier-transform_infrared_spectroscopy Lego Optics Table - https://www.instructables.com/id/Michelson-Interferometer-build-from-LEGOR-bricks/ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium Or check out my merch store at: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My Social Media Pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu __________________________________________________________________ Music: Dance, Don't Delay by Twin Musicom is licensed under a Creative Commons Attribution license (https://creativecommons.org/licenses/by/4.0/) Source: http://www.twinmusicom.org/song/303/dance-dont-delay Artist: http://www.twinmusicom.org Electro Sketch by Kevin MacLeod is licensed under a Creative Commons Attribution license (https://creativecommons.org/licenses/by/4.0/) Source: http://incompetech.com/music/royalty-free/?keywords=electro+sketch&Search=Search Artist: http://incompetech.com/ Boom by Audionautix is licensed under a Creative Commons Attribution license (https://creativecommons.org/licenses/by/4.0/) Artist: http://audionautix.com/ Ooh Hey by Audionautix is licensed under a Creative Commons Attribution license (https://creativecommons.org/licenses/by/4.0/) Artist: http://audionautix.com/ How it Begins by Kevin MacLeod is licensed under a Creative Commons Attribution license (https://creativecommons.org/licenses/by/4.0/) Source: http://incompetech.com/music/royalty-free/index.html?isrc=USUAN1100200 Artist: http://incompetech.com/

One of the first things you learn in microbiology is how to make media, and when you think about it, it makes sense. Microbes are tiny and only have what we give them. So if we don't provide what they need, they simply won't grow. Growing microbes can be very rewards wether you're making your own beer, or you're doing genetic engineering. In this video we explore the 5 different kinds of media and what goes into them. While the focus is on bacterial growth media, we also touch on what's needed to grow plant and animal cells. We'll be using the techniques in this video in the future when we start genetically engineering microbes to do everything from glow to change colors on cue. Once we have our plates, we'll want to streak them with bacteria. To learn how head over to the scihouse channel to learn all about the process: https://www.youtube.com/watch?v=RMtdpP1ONx0 While you're there, be sure to check out our gene gun and trauma foam projects: Gene Gun- https://www.youtube.com/watch?v=gB3N3aGDB60&t=2s Trauma Foam- https://www.youtube.com/watch?v=871asVUkOIE&t=1s __________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium Or check out my merch store at: https://www.redbubble.com/people/chironex/shop __________________________________________________________________ My other social media pages: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

Supercapacitors are amazing devices that are known for their incredible power density. But the ones on the market aren't as energy dense as is required for them to out compete lithium batteries. In this video we explore all of the basics of supercapacitor building, from making electrode paints, to selection of current collectors, to measuring the completed cells. While we only build a very simple cell in the video, the same basic recipe is useful for a variety of chemistries, including those that use graphene and carbon nanotubes. Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium Or check out my merch store at: https://www.redbubble.com/people/chironex/shop My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Anita Fowler -Jonas Abreu

Over a year ago I put out my first video on making carbon based quantum dots using hydrothermal methods. While they were very interesting, the color choices were limited exclusively to the same shade of blue no matter what carbon source is used. So in this video we explore a different method that allows us to make different colors. This also gives us a chance to examine a particularly poorly written paper featured in a major journal and how we can make the science we present to the world easier to replicate. First the methods described in the paper are followed to show how simple changes in wording can make a massive difference in how the reaction is set up and progresses. In this case it's the difference between something being made, and nothing being made. We manage to syntehsize 2 new colors so our spectrum of colors now includes yellows and green. Oranges and reds are still difficult, so if I ever figure those out, they'll have to be in a future video. Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium Or check out my merch store at: https://www.redbubble.com/people/chironex/shop My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Roshawn Terrel -Anita Fowler -Jonas Abreu

As I work there are lots of little spin off projects that aren't necessarily enough for a video of their own. Also I wanted to tweak the rewards on my Patreon to be of more value to you. This video is a grab bag of projects, pieces and some of the more interesting failures from the last little while that would otherwise never make it into a video. Working Plasma speaker and Plasma torch on Artems channel: Speaker- https://www.youtube.com/watch?v=WgNtfv5G9xg Plasma Flame - https://www.youtube.com/watch?v=nf3jol19Aus Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium Or check out my merch store at: https://www.redbubble.com/people/chironex/shop My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Roshawn Terrel -Anita Fowler -Jonas Abreu

You're probably wondering why you're here. Why'd you click on the video about the crazy people putting magnets in their fingers. Before I tell you, this isn't normally what we do on this channel. Normally we work on far more interesting and useful projects like building cameras that can see wifi, getting data off passing weather satellites, or engineering yeast to produce spider silk. Sound interesting? Here's some links: Wifi Camera: https://www.youtube.com/watch?v=g3LT_b6K0Mc Satellites: https://www.youtube.com/watch?v=jGWFg7EDnyY Spiders beer: https://www.youtube.com/watch?v=Fx8TcGrCOSI As to the magnets, the reason is simple. We're surrounded by metals and electromagnetic fields and yet we don't even notice they're there most of the time even though they are what make our world work. With a magnet (literally) in hand you're able to feel all of this information. Maybe it's the vibration of the transformer in your microwave, power running through a wire, or the metal or magnets in your various devices. Electricians will get them so they can feel the current running through a wire and have that tiny bit of extra sensation to warn them before they touch something that could kill them. Others will get them and then build devices to work in concert with the magnets, like ultrasonic range finders that let you feel the world from a distance. But mostly people get them because it's like a piercing with some extra party tricks. It doesn't need to have a use, it can just be cool, and that's ok too. For all other magnet questions, head over to: https://forum.biohack.me ________________________________________________________________ Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium Or check out my merch store at: https://www.redbubble.com/people/chironex/shop My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Roshawn Terrel -Anita Fowler -Jonas Abreu

The standard methods for DNA extraction has either been percipitation with ethanol, or running silica columns. Both are time consuming and as I sat in my genetics class in university, I wondered if there could be a better way. This video explores my idea for how the process can be improved. This experiment is unfinished and because of that, I need your help! If you've got access to a Nanodrop or Qubit and some DNA, send me a message at [email protected] and I'll send you a kit so you can test out the system. Anyone who helps will be listed as a coauthor on the paper this will be made into. Want to support the show and my research? Check out my patreon at: https://www.patreon.com/thethoughtemporium Or check out my merch store at: https://www.redbubble.com/people/chironex/shop My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Roshawn Terrel -Anita Fowler -Jonas Abreu

Because graphite is a bulk material and actually composed of millions of single atom thick sheets of carbon, it opens up new and interesting ways of modifying it's material properties. Using a process called intercalation it's possible to gentle force atoms and molecules in between the layers. These new compounds range from being supercondcutive, to semiconductive and some are even new states of matter called spin glasses. In this video we explore the first of these compounds and intercalate sulfuric acid. We then use our newly formed compound to produce expanded graphite and graphene. Merch Store: https://www.redbubble.com/people/chironex/shop My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ _____________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: https://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Terry Fuller -Jason Dunham -Roshawn Terrel -Anita Fowler -Jonas Abreu

The discovery of Planck's constant in the year 1900 was one of the most important discoveries that catalyzed the quantum revolution. What started as a simple idea to resolve one of the greatest physics mysteries of the time, turned out to be the key to unlocking the quantum realm. While Planck assumed that the constant would be 0 when measured the constant had a definite and real value, meaning that there was a lower limit on the universe. Preforming a basic version of this measurement is actually really easy and we explore the process of that measurement in this video using some LEDs and a diffraction grating. __________________________________________________________________ My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ For more info on Scihouse, check out the links below: Website: http://www.scihouse.space/ Facebook: https://www.facebook.com/scihousejax Instagram: https://www.instagram.com/scihousejax/ Twitter: https://twitter.com/scihousejax Youtube: https://www.youtube.com/channel/UCNmhA0cv119S6lF3FxRZRwQ Reddit: https://www.reddit.com/r/scihouse/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: https://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Terry Fuller -Roshawn Terrel -Anita Fowler -Jonas Abreu

Making custom PCBs is often viewed as something that only professionals can do, but that couldn't be farther from the truth. The materials are readily avialiable and the process is very straightforward. In this video we go through the process and explore how it can easily be done at home. We also look at how these techniques can be used to make special filters for radio frequencies. With these filters we can trim out any unwanted signals and noise, allowing us to more easily detect our target signal. We'll be using these filters in future projects, like building a hydrogen line radio telescope, or receiving signals from GOES-16. LINK TO THE PAPER I BASED THIS ON: http://www.w1ghz.org/filter/Recipes_for_Printed_Hairpin_Filters.pdf My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ For more info on Scihouse, check out the links below: Website: http://www.scihouse.space/ Facebook: https://www.facebook.com/scihousejax Instagram: https://www.instagram.com/scihousejax/ Twitter: https://twitter.com/scihousejax Youtube: https://www.youtube.com/channel/UCNmhA0cv119S6lF3FxRZRwQ Reddit: https://www.reddit.com/r/scihouse/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: https://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Terry Fuller -Roshawn Terrel -Anita Fowler -Jonas Abreu

2 of the most exciting carbon based materials currently being investigated by researchers are carbon nanotubes, and graphene. Adding small amounts of these to other materials can radically change the materials properties. From making highly conductive inks, to super strong materials, and even to computers, it seems the whole scientific world is trying to use these materials in one way or another. But how can they be manufactured? Of the two graphene is far easier to make as it can be harvested from naturally occurring materials. In this video we explore the easier way to make it in bulk and use a simple electrochemical method to shear the microscope layers of natural graphite apart into individual graphene sheets. If you'd like to help support Scihouse and the work we do, please head over to https://www.gofundme.com/scihousejax and check out our campaign. We appreciate your support at any level you feel comfortable with and even 5-10 bucks goes a long way towards helping us meet our goal. Thanks in advance -The Scihouse Team _________________________________________________________________ My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ For more info on Scihouse, check out the links below: Website: http://www.scihouse.space/ Facebook: https://www.facebook.com/scihousejax Instagram: https://www.instagram.com/scihousejax/ Twitter: https://twitter.com/scihousejax Youtube: https://www.youtube.com/channel/UCNmhA0cv119S6lF3FxRZRwQ Reddit: https://www.reddit.com/r/scihouse/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: https://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Terry Fuller -Roshawn Terrel -Anita Fowler -Jonas Abreu

In a previous video we looked at how it was possible to receive images directly off of weather satellites as they pass overhead. In this video we look at the last steps of that process and how we can convert our audio recordings into beautiful images of the earth.For the purposes of this video, we only use tools that have a gui. The programs we'll use are: Audacity: http://www.audacityteam.org/download/ WXtoIMG: https://wxtoimgrestored.xyz/ LRPTrx: https://www.dropbox.com/s/qq1fjyitpa3j14o/software.zip LRPTofflinedecoder: http://185.26.115.106/ Smooth Meteor: http://leshamilton.co.uk/meteor3m.htm LRPTimageprocessor: http://www.satsignal.eu/software/LRPT-processor.html Instructable: https://www.instructables.com/id/Receiving-Images-From-Passing-Weather-Satellites-N/ For the DIY GoogleEarth project, send your captures to: [email protected] __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: https://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Roshawn Terrel -Anita Fowler -Terry Fuller __________________________________________________________________ My social media links: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/

Since the invention of the microscope, we've been looking for better and better ways to see into the microscopic world. At first we used simple dyes to colour particular parts of a cell to make the pieces more clear. But as time went on we demanded something better. Enter immunofluorescent imaging. By combining a fluorescent dye and targeting molecule (an antibody), it's possible to specifically target a protein inside or out of a cell and make it glow, showing exactly where it is. This technique is being taken further by using these sorts of systems to tag cancer and make it glow under a uv light. This allows surgeons to find tumours they'd otherwise miss. This video is the first in a series where we'll be making such a system and this video covers the first step; converting fluorescein into a more useful form that can be attached to something else. __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: https://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Roshawn Terrel -Anita Fowler -Terry Fuller __________________________________________________________________ My social media links: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/

Leather is a fantastic material who's use has been pervasive through most of human history. But it's production is a scourge on the environment due to both the methods used to tan it, and the source of the starting material. In this video we explore a method for making a leather like material, without harming the environment, and without having to harm any animals. The starting material is a waste product from a drink that is becoming increasingly popular: Kombucha. As kombucha cultures grow, a layer of cellulose and proteins grow on the surface of the liquid. With a bit of simple processing, this layer can be transformed into an incredibly strong and flexible material that looks and feels like real leather. This research was made possible by Scihouse and this is far from the last you'll be seeing on this topic. All of us at scihouse are very excited about this technology and are working hard to continue to improve and develop it. Check out Scihouse's new channel and subscribe to get updates about this and our many other projects. __________________________________________________________________ My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ For more info on Scihouse, check out the links below: Website: http://www.scihouse.space/ Facebook: https://www.facebook.com/scihousejax Instagram: https://www.instagram.com/scihousejax/ Twitter: https://twitter.com/scihousejax Youtube: https://www.youtube.com/channel/UCNmhA0cv119S6lF3FxRZRwQ Reddit: https://www.reddit.com/r/scihouse/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: https://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Roshawn Terrel -Anita Fowler

Plasma is one of the weirder states of matter but learning to harness it has provided our species with almost all of our best technology. This video first explores what plasma is and how to make it, and then explores how we can use it to make functional devices. Everything from building a high voltage system from scratch, to learning how vacuum systems work is covered and is used to build simple fusion reactors, magnetrons and more. Parts of this video were in the process of being made for over 6 years, so I'm very excited to finally share it with the world. Many of the newer parts were filmed at Scihouse and this video wouldn't have been possible without Scihouse. For more info on Scihouse, check out the links below: Website: http://www.scihouse.space/ Facebook: https://www.facebook.com/scihousejax Instagram: https://www.instagram.com/scihousejax/ Twitter: https://twitter.com/scihousejax Reddit: https://www.reddit.com/r/scihouse/ __________________________________________________________________ My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/ __________________________________________________________________ Useful links: Making a Scariac - https://www.youtube.com/watch?v=P9UjxG8sN1c Inductive ballasts - http://www.lisungroup.com/article-id-167.html Fusor forums - fusor.net Applied science Magnetron - https://www.youtube.com/watch?v=9OEz_e9C4KM Circuit tool - http://www.falstad.com/circuit/ __________________________________________________________________ As always, thanks to my awesome Patrons for helping to make these video possible. If you're like to support the continued production of science videos like this one, consider donating: hhtps://patreon.com/thethoughtemporium Thanks to: -Jesse Hughes -Roshawn Terrel -Anita Fowler

In this video I explore some of the basic techniques required to work in a microbiology lab. By starting with a safe and easy to grow organism, we are able to learn the basics at a low cost. In this case we're using Saccharomyces cerevisiae also known as ordinary brewers yeast. The best part of this is while we learn biology techniques, we also end up with a delicious adult beverage. In the future, these skills will let us look at more difficult organisms, and progress to doing genetic modification and other higher level biology techniques. _________________________________________________________________ Interested in biohacking, transhumanism and futurism? Be sure to check out the guys at the dangerous minds podcast: http://www.dangerousminds.io/ __________________________________________________________________ Thanks to all my amazing patrons who help make these videos possible! Your continued donations and support allow me to continue to make awesome content. Thanks to: Anita Fowler Jesse Hughes Roshawn Terrell https://patreon.com/thethoughtemporium __________________________________________________________________ To learn more about Scihouse, check out some of the links below! Website: http://www.scihouse.space/ Facebook: https://www.facebook.com/scihousejax Instagram: https://www.instagram.com/scihousejax/ Twitter: https://twitter.com/scihousejax Reddit: https://www.reddit.com/r/scihouse/ __________________________________________________________________ My social media stuff: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/

Over the last 2 months me and my friend Artem (you met him in the last video) built our first radio telescope. It was built mostly out of off the shelf components, like a satellite dish and Ku band LNB, as well as some parts we 3d printed. When all was said and done we had a system that could not only take images of the sky in radip frequencies (in this case 10-12ghz), but could also be used to track satellites. With it, we were able to see the ring of satellites in geosynchronous orbit, over 35,000km away, This is only the first of what I suspect will be many more telescopes like this. Next time we'll be building ones that are far larger and can see things like the hydrogen lines so we can image the milky way. If you enjoyed this video and would like to support the continued production of videos like it, considering checking out my patreon: https://www.patreon.com/thethoughtemporium Thanks to all my amazing patrons who help make these videos possible! Your continued donations and support allow me to continue to make awesome content. Thanks to: Anita Fowler Jesse Hughes Roshawn Terrell __________________________________________________________________ Pulling images from satellites: https://youtu.be/cjClTnZ4Xh4 __________________________________________________________________ Other social media links: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Website: http://thethoughtemporium.com/ __________________________________________________________________ Artems work: Youtube (theartlav): https://www.youtube.com/user/val3tra Sound camera: https://www.ribbonfarm.com/2016/06/29/the-daredevil-camera/ Thermal camera made from heat seeking missile parts: https://www.ribbonfarm.com/2016/05/12/artem-vs-predator/ Other awesome stuff: http://orbides.org/ __________________________________________________________________

Over the past 2 months, me and my friend Artem have been building antennas to receive signals from weather satellites as they pass overhead. This video chronicles our progress through this project and goes through some of the science involved in working with radio and receiving transmissions. We explore how dipoles work and how to build them, and how we built our final double cross antenna. We used an SDR (software defined radio) called a HackRF to do the work of interpreting the received signals and then decoded them with some special software. We pulled images from 4 satellites: NOAA 15, 18 and 19 as well as METEOR M2. The satellites broadcast immediately as they take the images and no images are stored, so we're likely the only ones on earth with these images. Prefer written instructions? Check out our new instructable for more information on this process: https://www.instructables.com/id/Receiving-Images-From-Passing-Weather-Satellites-N/ _________________________________________________________________ Artem Litvinovich and some of his work: Youtube (theartlav): https://www.youtube.com/user/val3tra Sound camera: https://www.ribbonfarm.com/2016/06/29/the-daredevil-camera/ Thermal camera made from heat seeking missile parts: https://www.ribbonfarm.com/2016/05/12/artem-vs-predator/ Other awesome stuff: http://orbides.org/ _________________________________________________________________ Other social media links: Patreon:https://www.patreon.com/thethoughtemporium Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Website: http://thethoughtemporium.com/ __________________________________________________________________ Photo gallery: https://www.facebook.com/pg/thethoughtemporium/photos/?tab=album&album_id=1920871801482540 __________________________________________________________________ Satellite tracking site: www.n2yo.com Satellite tracking software (orbitron): http://www.stoff.pl/ Build a Helical (QFH) antenna: http://www.g4ilo.com/qfh.html Building a double cross antenna: http://www.qsl.net/py4zbz/DCA.pdf Full guide on how to do this: http://www.rtl-sdr.com/rtl-sdr-tutorial-receiving-noaa-weather-satellite-images/

2016 has been both a fantastic year and a very productive one. It wasn't until I made this video that I realized the full breadth of my work. Starting with my first experiments with nanotechnology, and quickly moving into some work with bioremediation. Biohacking con was near the begining and was an absolute blast. By the time summer rolled around I had gotten the hang of nanotech and was making more and more complex materials. I worked with graphene, and semiconductors. I built kilns and furnaces. What an incredible year! Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: @thethoughtemporium or https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex Music: Bensound - Happy guitar, pop dance, rumble

The first of many great successes coming out of exosphere. For part of my project I've been working on a fungus capable of rapidly decomposing plastics. It's an incredibly aggressive form of P. microspora discovered in the amazon. If you'd like to follow along on the project and all the other things we do here, check out the social media links below, and if you'd like to be a part of the next exosphere go to http://exs.ph/2bC7fJl The next exosphere program looks like it'll be even better than this one and best of all I'll be teaching a course! I'll be teaching a stream focused on energy storage, and microbial fuel cell technology. And since it's exosphere it's an entirely hands on course. Apply soon to join us in Brazil and do real science and learn science the way it was meant to be taught. Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: @thethoughtemporium or https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

I've spent almost a year working with nanotech and these are some of my experiments trying to synthesize carbon nanotubes. This isn't my first time trying but I'm certainly getting better at it. I'm out of time before my trip but I'll be returning to this after the summer and will hopefully see success. Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

In this video I show a simple method for producing copper 1 oxide using only common and readily available reagents. All you'll need is a copper salt, almost any soluble one will work, some ascorbic acid and some sodium hydroxide. We first react the sodium hydroxide with the copper salt to produce copper hydroxide then we gently reduce it to copper oxide using the ascorbic acid. Social media links: Facebook: https://www.facebook.com/thethoughtem... Website: http://www.thethoughtemporium.com/ Instagram: @thethoughtemporium or https://www.instagram.com/thethoughte... Twitter: @TTEchironex

This video is an update of my last styrofoam worms video. If you haven't seen that one, here's a link: https://www.youtube.com/watch?v=TS9PWzkUG2s In this video I show off the progress I've made on this project and the construction of what I've called my styrofoam digestion chamber which uses a species of beetle larva to break down styrofoam in a couple of weeks to months, rather than hundreds of years. Social media links: Facebook: https://www.facebook.com/thethoughtem... Website: http://www.thethoughtemporium.com/ Instagram: @thethoughtemporium or https://www.instagram.com/thethoughte... Twitter: @TTEchironex

In this video I show the process of decellularizing plant tissue. I tried strawberries, broccoli, mushrooms and apples. The process washes away all the cellular material leaving you with a ghostly mostly cellulose scaffold. This video was inspired by the work of Andrew Pelling and was based on of this paper: http://www.pellinglab.net/wp-content/uploads/2013/04/Modulevsky_PlosOne_20141.pdf Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

In this video i take you through the process of making carbon nanofoam through hydrothermal synthesis. The foam has incredible surface area and as such will make a great supercapacitor electrode material. This video was based off of the paper "Ultralight carbon nanofoam from naphtalene-mediated hydrothermal sucrose carbonization" https://www.hawaii.edu/news/attachments/pdf7422_5421.pdf Social media links: Facebook: https://www.facebook.com/thethoughtemporium/ Website: http://www.thethoughtemporium.com/ Instagram: @thethougthemporium Twitter: @TTEchironex

In this video I show how you can make a simple membrane cell from commonly available materials. By using only baking soda and distilled water you can easily make a corrosive solution of sodium hydroxide in a few hours. Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

I was playing around with the conditions I used to make the magnetic nanoparticles and stumbled onto this. I need to do more tests but it's a cool starting point. I forgot to mention in the video but the first microscope image was of particles grown for 8 hours, the others were for 24 hours. You can see there's a lot more junk at 24 hours but not many more spiky structures. Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

A paper came out recently showing the common mealworms could eat, survive on and break down styrofoam. I decided to test this with a different species to see if this is something more insects could do. And sure enough they can! Could be a great way to deal with our plastics, feed them to the bugs! Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

In this video I show how to use hydrothermal synthesis to make high quality and highly conductive coper sulfide. It may even be forming nanotubes. Facebook: https://www.facebook.com/thethoughtemporium Website: thethoughtemporium.com Instagram: thethoughtemporium

In this video I show a method of making magnetic nanoparticles using hydrothermal synthesis. They're fun to play with and mesmerizing to watch. They're also the subject of future videos. Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

Hydrothermal carbonization is an amazing technique that allows for the creation of a diverse range of nanoparticles. This video introduces the idea of hydrothermal carbonization and what it's capable of. Quantum dots are particles that are right on the edge between single molecules, and large particles. As such they have all sorts of weird properties. One property is that they are highly flourescent! Normally, they're made out of toxic semiconductors like cadmium sulfide, but in this video I show how they can be made out of carbon instead! Best of all, almost any carbon source can be used as the starting material. I've used everything from sugar, to gelatin to orange juice with great success. Social media: Instagram: https://www.instagram.com/thethoughtemporium/ Facebook: https://www.facebook.com/thethoughtemporium/ Twitter: https://www.twitter.com/TTEchironex Website: http://thethoughtemporium.com/

My method for making glass vacuum chambers. Use at your own risk, since they're glass any imperfections can cause them to break and even perfect ones have been made to fail if you stress them too much. Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex

My facebook page: http://www.facebook.com/pages/Thechemlife/128028337270470 Plant resources: http://www.sarracenia.com/faq.html (one of the best sites going) http://www.carnivorousplantnursery.com/info/growing.htm http://www.carnivorous--plants.com/care-of-carnivorous-plants.html http://www.flytrapcare.com/ My second channel: http://www.youtube.com/user/tclvlogs?feature=mhee My website: thechemlife.com

Back in 2011, the whole city I was in practically shook as a massive lightning storm rolled in. Not only was there a lot of the usual negative lightning, there was also an unusual amount of positive lightning. Positive lightning, unlike the negative variety, tends to travel upwards. This was some of the best footage I could get at the time. I slowed some clips down so the progression of the lightning can be seen clearly

When I was in highschool, I was fascinated by fusors and fusion. I couldn't believe that such extreme conditions could be created in something so simple. I spent most of 10th grade learning everything I could about high voltage, vacuum systems and fusors, all while trying to build one of my own. After over a years work, I finally managed to make one that worked! It was a demonstraction model, so it couldn't achieve fusion temperatures, but it did all the other things a fusor should do. I built the whole system out of random nonsense I found laying around. I used a pasta sauce jar as my main chamber, a microwave transformer as my power source, a spark plug, some spare tubing and plumbing parts, and originally the compressor out of a fridge. I learned a lot building this system and the skills I gained continue to serve me well. Social media links: Facebook: https://www.facebook.com/thethoughtemporium Website: http://www.thethoughtemporium.com/ Instagram: https://www.instagram.com/thethoughtemporium Twitter: @TTEchironex